Incidental Mutation 'R1131:Tnrc6b'
ID94658
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80894453 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1209 (Q1209L)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689] [ENSMUST00000227449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: Q1209L

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: Q1209L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect unknown
Transcript: ENSMUST00000228124
AA Change: Q356L
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCTAGTAACTGTCCACCAACCTCC -3'
(R):5'- AGTCAGTATTCCAGCAGGCAGCTC -3'

Sequencing Primer
(F):5'- GAATGCTGTCATTCCATGCAGTAG -3'
(R):5'- TTCAGGCAGATACTTGAGGGC -3'
Posted On2014-01-05