Incidental Mutation 'R1131:Tcirg1'
ID94664
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene NameT cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
SynonymsAtp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3896050-3907133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3896301 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 799 (S799P)
Ref Sequence ENSEMBL: ENSMUSP00000122474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000135070] [ENSMUST00000145791]
Predicted Effect probably damaging
Transcript: ENSMUST00000001801
AA Change: S799P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: S799P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122885
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect probably damaging
Transcript: ENSMUST00000126070
AA Change: S799P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: S799P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126643
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131327
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134698
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145791
AA Change: S799P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: S799P

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162688
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3899108 missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3904210 splice site probably benign
IGL03143:Tcirg1 APN 19 3898811 missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3897866 missense possibly damaging 0.56
R1223:Tcirg1 UTSW 19 3898733 missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3896845 missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3898835 missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3902843 intron probably benign
R2262:Tcirg1 UTSW 19 3903591 missense possibly damaging 0.89
R4367:Tcirg1 UTSW 19 3899069 missense probably damaging 1.00
R5327:Tcirg1 UTSW 19 3902342 critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3903509 splice site probably null
R5551:Tcirg1 UTSW 19 3898858 missense probably damaging 1.00
R5930:Tcirg1 UTSW 19 3902424 missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3897487 missense probably benign
R6517:Tcirg1 UTSW 19 3901933 missense probably damaging 1.00
R7039:Tcirg1 UTSW 19 3896666 missense probably damaging 1.00
R7181:Tcirg1 UTSW 19 3903576 missense probably null 0.56
Predicted Primers PCR Primer
(F):5'- GGTATCCCAGCAGCATCTAAAGGC -3'
(R):5'- GTGTGACAGGCATTCACAAATTCCC -3'

Sequencing Primer
(F):5'- ACTCTGCTGAAGAATGGTCC -3'
(R):5'- TTGTGTGCAGAGCTGTCTGA -3'
Posted On2014-01-05