Incidental Mutation 'R1132:Car9'
ID 94677
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 039205-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1132 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 43512439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183] [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914]
AlphaFold Q8VHB5
Predicted Effect probably null
Transcript: ENSMUST00000030183
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030184
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107913
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107914
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect probably null
Transcript: ENSMUST00000138073
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,894,917 (GRCm39) V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,093,420 (GRCm39) probably benign Het
C3 C T 17: 57,514,531 (GRCm39) probably null Het
Cd163 G T 6: 124,286,055 (GRCm39) G202* probably null Het
Cdk8 A G 5: 146,236,625 (GRCm39) T347A probably benign Het
Cep170 C A 1: 176,577,603 (GRCm39) R1257L probably damaging Het
Cib1 A G 7: 79,877,778 (GRCm39) F168S probably damaging Het
Cntnap5c G A 17: 58,601,351 (GRCm39) G833D probably damaging Het
Dhx37 A T 5: 125,498,103 (GRCm39) I702N probably damaging Het
Dnah3 T C 7: 119,538,227 (GRCm39) K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 122,279,015 (GRCm39) probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 122,279,019 (GRCm39) probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,153,722 (GRCm39) probably benign Het
Gaa T C 11: 119,175,885 (GRCm39) S953P probably damaging Het
Inpp5j T C 11: 3,452,305 (GRCm39) E315G possibly damaging Het
Itsn2 T C 12: 4,708,464 (GRCm39) Y840H probably damaging Het
Kif1a T C 1: 92,983,743 (GRCm39) E653G probably damaging Het
Loxhd1 T C 18: 77,517,639 (GRCm39) V1829A possibly damaging Het
Myh8 C T 11: 67,187,957 (GRCm39) Q910* probably null Het
Or12d12 T C 17: 37,610,423 (GRCm39) R297G probably benign Het
Or14a257 A T 7: 86,138,425 (GRCm39) F111L probably benign Het
Or14j4 G T 17: 37,921,333 (GRCm39) T103K possibly damaging Het
Or2ag17 A T 7: 106,389,758 (GRCm39) I150N possibly damaging Het
Prdm4 A G 10: 85,735,145 (GRCm39) S666P probably damaging Het
Rad50 T C 11: 53,585,788 (GRCm39) K331E possibly damaging Het
Rbbp6 A G 7: 122,599,336 (GRCm39) probably benign Het
Selenbp1 C G 3: 94,844,644 (GRCm39) I100M probably benign Het
Skint6 A G 4: 112,755,296 (GRCm39) probably null Het
Stac3 T C 10: 127,343,128 (GRCm39) S208P probably benign Het
Tfap2a T C 13: 40,874,867 (GRCm39) probably null Het
Trhde T C 10: 114,248,383 (GRCm39) K939E possibly damaging Het
Vmn1r22 T C 6: 57,877,826 (GRCm39) I50M probably benign Het
Vmn1r39 C T 6: 66,781,428 (GRCm39) V260I probably benign Het
Zdhhc25 T C 15: 88,484,926 (GRCm39) L87P probably damaging Het
Zfp202 T C 9: 40,122,318 (GRCm39) L360P probably benign Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4033:Car9 UTSW 4 43,508,624 (GRCm39) missense possibly damaging 0.52
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCGTGATTCTCGGCTACAACTGAAC -3'
(R):5'- CTTCCAGCAGCTAGGTGAAAGGTG -3'

Sequencing Primer
(F):5'- ACCCTTGAATGGGCGAAC -3'
(R):5'- AGATTTCTGGAGCCTCATTCAGAC -3'
Posted On 2014-01-05