Mutagenetix > Incidental Mutation

Incidental Mutation 'R1132:Cib1'

94708

Institutional Source

Beutler Lab

Gene Symbol

Cib1

Ensembl Gene

ENSMUSG00000030538

Gene Name

calcium and integrin binding 1

Synonyms

Kip

MMRRC Submission

039205-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1132 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79876904-79882553 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79877778 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 168 (F168S)

Ref Sequence

ENSEMBL: ENSMUSP00000145961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000062915] [ENSMUST00000065163] [ENSMUST00000071457] [ENSMUST00000123279] [ENSMUST00000206084] [ENSMUST00000206802] [ENSMUST00000205822] [ENSMUST00000205996]

AlphaFold

Q9Z0F4

Predicted Effect

probably benign
Transcript: ENSMUST00000032754

SMART Domains

Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Sema	57	494	8.07e-177	SMART
PSI	512	582	4.7e-9	SMART
low complexity region	626	639	N/A	INTRINSIC
transmembrane domain	701	723	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000062915

SMART Domains

Protein: ENSMUSP00000061808
Gene: ENSMUSG00000050973

Domain	Start	End	E-Value	Type
SCOP:d1kpf__	150	223	1e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065163
AA Change: F173S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070901
Gene: ENSMUSG00000030538
AA Change: F173S

Domain	Start	End	E-Value	Type
low complexity region	84	100	N/A	INTRINSIC
EFh	107	135	4.4e0	SMART
EFh	152	180	1.17e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000071457
AA Change: F125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071401
Gene: ENSMUSG00000030538
AA Change: F125S

Domain	Start	End	E-Value	Type
low complexity region	36	52	N/A	INTRINSIC
EFh	59	87	4.4e0	SMART
EFh	104	132	1.17e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123279
AA Change: F99S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118926
Gene: ENSMUSG00000030538
AA Change: F99S

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
EFh	33	61	4.4e0	SMART
EFh	78	106	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144295

Predicted Effect

probably damaging
Transcript: ENSMUST00000206084
AA Change: F168S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206802

Predicted Effect

probably benign
Transcript: ENSMUST00000205822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206211

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206618

Predicted Effect

probably benign
Transcript: ENSMUST00000205996

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.3%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutation of this gene results in male infertility due to disruption of the haploid phase of spermatogenesis and is associated with small testis size and loss of elongated spermatids and sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apba1	T	C	19: 23,894,917 (GRCm39)	V451A	possibly damaging	Het
Atxn2l	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	7: 126,093,420 (GRCm39)		probably benign	Het
C3	C	T	17: 57,514,531 (GRCm39)		probably null	Het
Car9	G	T	4: 43,512,439 (GRCm39)		probably null	Het
Cd163	G	T	6: 124,286,055 (GRCm39)	G202*	probably null	Het
Cdk8	A	G	5: 146,236,625 (GRCm39)	T347A	probably benign	Het
Cep170	C	A	1: 176,577,603 (GRCm39)	R1257L	probably damaging	Het
Cntnap5c	G	A	17: 58,601,351 (GRCm39)	G833D	probably damaging	Het
Dhx37	A	T	5: 125,498,103 (GRCm39)	I702N	probably damaging	Het
Dnah3	T	C	7: 119,538,227 (GRCm39)	K3586R	possibly damaging	Het
Fbxo31	ACGGCGCGGCG	ACGGCGCGGCGCGGCG	8: 122,279,015 (GRCm39)		probably null	Het
Fbxo31	CGCGG	CGCGGAGCGG	8: 122,279,019 (GRCm39)		probably null	Het
Fhod3	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGA	18: 25,153,722 (GRCm39)		probably benign	Het
Gaa	T	C	11: 119,175,885 (GRCm39)	S953P	probably damaging	Het
Inpp5j	T	C	11: 3,452,305 (GRCm39)	E315G	possibly damaging	Het
Itsn2	T	C	12: 4,708,464 (GRCm39)	Y840H	probably damaging	Het
Kif1a	T	C	1: 92,983,743 (GRCm39)	E653G	probably damaging	Het
Loxhd1	T	C	18: 77,517,639 (GRCm39)	V1829A	possibly damaging	Het
Myh8	C	T	11: 67,187,957 (GRCm39)	Q910*	probably null	Het
Or12d12	T	C	17: 37,610,423 (GRCm39)	R297G	probably benign	Het
Or14a257	A	T	7: 86,138,425 (GRCm39)	F111L	probably benign	Het
Or14j4	G	T	17: 37,921,333 (GRCm39)	T103K	possibly damaging	Het
Or2ag17	A	T	7: 106,389,758 (GRCm39)	I150N	possibly damaging	Het
Prdm4	A	G	10: 85,735,145 (GRCm39)	S666P	probably damaging	Het
Rad50	T	C	11: 53,585,788 (GRCm39)	K331E	possibly damaging	Het
Rbbp6	A	G	7: 122,599,336 (GRCm39)		probably benign	Het
Selenbp1	C	G	3: 94,844,644 (GRCm39)	I100M	probably benign	Het
Skint6	A	G	4: 112,755,296 (GRCm39)		probably null	Het
Stac3	T	C	10: 127,343,128 (GRCm39)	S208P	probably benign	Het
Tfap2a	T	C	13: 40,874,867 (GRCm39)		probably null	Het
Trhde	T	C	10: 114,248,383 (GRCm39)	K939E	possibly damaging	Het
Vmn1r22	T	C	6: 57,877,826 (GRCm39)	I50M	probably benign	Het
Vmn1r39	C	T	6: 66,781,428 (GRCm39)	V260I	probably benign	Het
Zdhhc25	T	C	15: 88,484,926 (GRCm39)	L87P	probably damaging	Het
Zfp202	T	C	9: 40,122,318 (GRCm39)	L360P	probably benign	Het

Other mutations in Cib1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0042:Cib1	UTSW	7	79,880,126 (GRCm39)	missense	probably benign	0.00
R1548:Cib1	UTSW	7	79,878,162 (GRCm39)	nonsense	probably null
R1964:Cib1	UTSW	7	79,882,120 (GRCm39)	missense	possibly damaging	0.90
R7203:Cib1	UTSW	7	79,882,120 (GRCm39)	missense	possibly damaging	0.90
R7998:Cib1	UTSW	7	79,878,162 (GRCm39)	nonsense	probably null
R8427:Cib1	UTSW	7	79,877,749 (GRCm39)	missense	probably damaging	1.00
R8799:Cib1	UTSW	7	79,882,291 (GRCm39)	missense	probably damaging	1.00
R8950:Cib1	UTSW	7	79,878,211 (GRCm39)	missense	probably damaging	1.00
R9123:Cib1	UTSW	7	79,877,751 (GRCm39)	missense	probably damaging	1.00
R9125:Cib1	UTSW	7	79,877,751 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGTACAGCCCTGACTAACCATAC -3'
(R):5'- CTTTGATGACGATGGAACCCTGGAC -3'

Sequencing Primer
(F):5'- agcctgcctttgccttc -3'
(R):5'- AGCCAGCTTGTGAATTGCC -3'

Posted On

2014-01-05