Incidental Mutation 'R1132:Atxn2l'
List |< first << previous [record 51 of 585] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Nameataxin 2-like
SynonymsA2lp, A2D, A2RP, A2LG
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R1132 (G1)
Quality Score110
Status Not validated
Chromosomal Location126491708-126503437 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC at 126494248 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000098048] [ENSMUST00000106392] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000179818] [ENSMUST00000206055] [ENSMUST00000206265] [ENSMUST00000206572] [ENSMUST00000206577]
Predicted Effect probably benign
Transcript: ENSMUST00000040202
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637

low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098048
SMART Domains Protein: ENSMUSP00000095656
Gene: ENSMUSG00000073838

Pfam:GTP_EFTU 55 249 2e-55 PFAM
Pfam:GTP_EFTU_D2 272 341 1.3e-15 PFAM
Pfam:GTP_EFTU_D3 345 440 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106392
SMART Domains Protein: ENSMUSP00000102000
Gene: ENSMUSG00000073838

Pfam:GTP_EFTU 55 249 2.7e-57 PFAM
Pfam:GTP_EFTU_D2 272 341 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166682
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637

Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167759
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637

Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179818
SMART Domains Protein: ENSMUSP00000137108
Gene: ENSMUSG00000032637

Pfam:SM-ATX 62 132 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206055
Predicted Effect probably benign
Transcript: ENSMUST00000206265
Predicted Effect probably benign
Transcript: ENSMUST00000206572
Predicted Effect probably benign
Transcript: ENSMUST00000206577
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0749:Atxn2l UTSW 7 126500837 missense possibly damaging 0.50
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R1919:Atxn2l UTSW 7 126493168 missense probably damaging 0.99
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R2170:Atxn2l UTSW 7 126503239 start gained probably benign
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6022:Atxn2l UTSW 7 126496435 critical splice donor site probably null
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-05