Incidental Mutation 'R1132:Apba1'
ID94783
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23917553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 451 (V451A)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025830
AA Change: V451A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: V451A

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1291:Apba1 UTSW 19 23917672 missense probably damaging 0.97
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AACAGACTGTCTGAGCCTCCCAAG -3'
(R):5'- CCACTGTCTAAGAGCTGTGGGTTG -3'

Sequencing Primer
(F):5'- cctcccaagcaactaggattac -3'
(R):5'- GTTGACACTGCCTGCTCAG -3'
Posted On2014-01-05