Incidental Mutation 'R1025:Alyref'
List |< first << previous [record 93 of 1871] next >> last >|
ID94906
Institutional Source Beutler Lab
Gene Symbol Alyref
Ensembl Gene ENSMUSG00000025134
Gene NameAly/REF export factor
SynonymsREF1, Thoc4, Refbp1
MMRRC Submission 039127-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1025 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120592121-120598365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 120595932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 168 (V168L)
Ref Sequence ENSEMBL: ENSMUSP00000026125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026125] [ENSMUST00000026128] [ENSMUST00000093140]
PDB Structure
SOLUTION STRUCTURE OF THE NUCLEAR FACTOR ALY RBD DOMAIN [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000026125
AA Change: V168L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026125
Gene: ENSMUSG00000025134
AA Change: V168L

DomainStartEndE-ValueType
low complexity region 16 53 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
RRM 106 178 7.64e-20 SMART
FoP_duplication 187 255 1.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026128
SMART Domains Protein: ENSMUSP00000026128
Gene: ENSMUSG00000025135

DomainStartEndE-ValueType
RING 23 76 4.48e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093140
SMART Domains Protein: ENSMUSP00000097714
Gene: ENSMUSG00000025135

DomainStartEndE-ValueType
RING 23 76 4.48e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156685
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A T 17: 48,090,510 K105M probably damaging Het
3110009E18Rik C T 1: 120,171,462 T95I probably damaging Het
Ap1g1 G A 8: 109,818,939 A75T probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Baz2b T C 2: 59,962,482 N434S probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Cpne4 A T 9: 104,993,858 I300F possibly damaging Het
Fsip2 C A 2: 82,989,436 S5171* probably null Het
Gabra2 T C 5: 70,973,595 S297G probably damaging Het
Gm498 A G 7: 143,896,390 Y291C probably damaging Het
Irak3 A T 10: 120,176,346 I171N probably damaging Het
Lama1 A G 17: 67,752,898 I661V probably benign Het
Macf1 T C 4: 123,473,816 D2384G probably damaging Het
Olfr1415 T A 1: 92,491,723 T11S probably benign Het
Olfr307 T C 7: 86,335,905 M164V probably benign Het
Pdcd6ip G A 9: 113,662,286 L630F probably damaging Het
Pkn2 A G 3: 142,821,565 probably null Het
Slc26a4 T G 12: 31,528,737 D639A probably damaging Het
Svep1 C T 4: 58,087,817 C1754Y possibly damaging Het
Trpa1 C A 1: 14,904,183 M258I probably benign Het
Vmn1r17 A T 6: 57,361,255 S42T probably benign Het
Vmn2r57 A G 7: 41,427,804 F313L probably benign Het
Zfp811 A G 17: 32,798,644 Y140H probably benign Het
Other mutations in Alyref
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Alyref APN 11 120595936 missense possibly damaging 0.87
IGL02210:Alyref APN 11 120597673 missense possibly damaging 0.78
IGL02372:Alyref APN 11 120594875
IGL02424:Alyref APN 11 120595307 missense probably benign 0.07
IGL03102:Alyref APN 11 120597765 missense possibly damaging 0.65
R0234:Alyref UTSW 11 120598307 missense probably damaging 1.00
R1026:Alyref UTSW 11 120595932 missense probably damaging 0.97
R1951:Alyref UTSW 11 120595932 missense probably damaging 0.97
R1952:Alyref UTSW 11 120595932 missense probably damaging 0.97
R4591:Alyref UTSW 11 120595973 missense probably benign 0.23
R4905:Alyref UTSW 11 120596053 unclassified probably null
R5116:Alyref UTSW 11 120597728 missense probably benign 0.06
R6450:Alyref UTSW 11 120596046 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCACAAGAGGTTGGTCCAGATG -3'
(R):5'- TGGACAGTAACCCAGTTGTTCGC -3'

Sequencing Primer
(F):5'- CCAGATGTGTGGGGCAG -3'
(R):5'- GGCTGTCAGTCAAGTACCTCTAAAG -3'
Posted On2014-01-05