Incidental Mutation 'R1135:Nox4'
ID94921
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 039208-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1135 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87323789 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 335 (P335S)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably damaging
Transcript: ENSMUST00000032781
AA Change: P335S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: P335S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068829
AA Change: P335S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: P335S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik G T 4: 147,944,658 V362L probably benign Het
Ak5 T A 3: 152,653,662 L166F probably damaging Het
Camk2a T A 18: 60,957,396 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cr2 A T 1: 195,157,190 I643N probably damaging Het
Fibin G A 2: 110,362,222 H192Y probably benign Het
Ints11 T C 4: 155,887,927 probably null Het
Lct A G 1: 128,294,124 probably null Het
Msantd2 A G 9: 37,522,712 I83V probably damaging Het
Myh10 A T 11: 68,807,197 M1622L probably benign Het
Nkx2-4 G T 2: 147,084,408 S178* probably null Het
Rab3gap2 G A 1: 185,275,943 R1085Q possibly damaging Het
Skint10 C T 4: 112,711,463 W352* probably null Het
Srsf4 T G 4: 131,900,069 probably benign Het
Sytl1 C T 4: 133,256,970 G274D probably damaging Het
Tbck T A 3: 132,732,191 I459N probably damaging Het
Trhr2 A G 8: 122,358,633 L204P probably damaging Het
Vps13d T C 4: 145,155,589 T1145A probably benign Het
Wnk2 G A 13: 49,076,558 P830L probably damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGTCACGAACTTCAATGTACAGA -3'
(R):5'- TGCTGATACACTGGGGCAATGGA -3'

Sequencing Primer
(F):5'- CTCACAATTTCATTGCTGAGAGC -3'
(R):5'- CACTGGGGCAATGGAGAATAATATAC -3'
Posted On2014-01-05