Mutagenetix > Incidental Mutation

Incidental Mutation 'R1026:Ppp1r12a'

94979

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r12a

Ensembl Gene

ENSMUSG00000019907

Gene Name

protein phosphatase 1, regulatory subunit 12A

Synonyms

1200015F06Rik, D10Ertd625e, 5730577I22Rik, Mypt1

MMRRC Submission

039128-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1026 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107997913-108115846 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108087720 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 58 (T58A)

Ref Sequence

ENSEMBL: ENSMUSP00000151478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263] [ENSMUST00000219759]

AlphaFold

Q9DBR7

Predicted Effect

probably benign
Transcript: ENSMUST00000070663
AA Change: T524A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: T524A

Domain	Start	End	E-Value	Type
ANK	38	68	1.01e2	SMART
ANK	72	101	1.66e-6	SMART
ANK	105	134	6.36e-3	SMART
ANK	138	168	5.52e2	SMART
ANK	198	227	6.12e-5	SMART
ANK	231	260	5.16e-3	SMART
coiled coil region	333	354	N/A	INTRINSIC
low complexity region	385	402	N/A	INTRINSIC
low complexity region	469	480	N/A	INTRINSIC
low complexity region	517	531	N/A	INTRINSIC
low complexity region	564	578	N/A	INTRINSIC
low complexity region	596	610	N/A	INTRINSIC
low complexity region	626	656	N/A	INTRINSIC
PDB:2KJY\|A	657	712	5e-12	PDB
low complexity region	719	745	N/A	INTRINSIC
low complexity region	771	794	N/A	INTRINSIC
low complexity region	815	833	N/A	INTRINSIC
low complexity region	836	851	N/A	INTRINSIC
low complexity region	883	902	N/A	INTRINSIC
Pfam:PRKG1_interact	930	993	4.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218773

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219068

Predicted Effect

probably benign
Transcript: ENSMUST00000219263
AA Change: T524A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000219759
AA Change: T58A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.5%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alyref	C	G	11: 120,486,758 (GRCm39)	V168L	probably damaging	Het
Cdc42bpg	T	C	19: 6,367,217 (GRCm39)	C919R	probably damaging	Het
Cgnl1	A	G	9: 71,624,713 (GRCm39)	S620P	possibly damaging	Het
Fbxw10	A	G	11: 62,765,997 (GRCm39)	T756A	probably benign	Het
Fsip2	T	C	2: 82,818,805 (GRCm39)	I4846T	possibly damaging	Het
Hebp2	G	T	10: 18,420,163 (GRCm39)	T90K	possibly damaging	Het
Map4k5	T	C	12: 69,921,062 (GRCm39)	K52R	possibly damaging	Het
Neb	T	A	2: 52,154,122 (GRCm39)	M2330L	possibly damaging	Het
Or14a258	T	A	7: 86,035,467 (GRCm39)	M134L	probably damaging	Het
Or8k21	T	C	2: 86,145,558 (GRCm39)	Q24R	possibly damaging	Het
Plekhf1	C	A	7: 37,921,065 (GRCm39)	A168S	probably benign	Het
Prss23	T	A	7: 89,159,166 (GRCm39)	Y301F	probably benign	Het
R3hdm1	A	G	1: 128,124,742 (GRCm39)	Y343C	probably damaging	Het
Zcchc17	C	T	4: 130,223,403 (GRCm39)	V128I	possibly damaging	Het
Zfp960	T	A	17: 17,308,518 (GRCm39)	C411S	probably damaging	Het

Other mutations in Ppp1r12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Ppp1r12a	APN	10	108,034,709 (GRCm39)	missense	probably damaging	1.00
IGL00727:Ppp1r12a	APN	10	108,066,334 (GRCm39)	missense	probably damaging	1.00
IGL00819:Ppp1r12a	APN	10	108,076,682 (GRCm39)	missense	probably damaging	0.98
IGL01538:Ppp1r12a	APN	10	108,069,882 (GRCm39)	missense	probably damaging	1.00
IGL02227:Ppp1r12a	APN	10	108,105,185 (GRCm39)	missense	probably damaging	1.00
IGL02957:Ppp1r12a	APN	10	108,034,779 (GRCm39)	missense	probably damaging	0.98
IGL03063:Ppp1r12a	APN	10	108,097,115 (GRCm39)	missense	probably damaging	1.00
IGL03260:Ppp1r12a	APN	10	108,097,106 (GRCm39)	missense	probably benign	0.10
R0049:Ppp1r12a	UTSW	10	108,089,193 (GRCm39)	missense	possibly damaging	0.63
R0268:Ppp1r12a	UTSW	10	108,109,242 (GRCm39)	intron	probably benign
R0826:Ppp1r12a	UTSW	10	108,066,414 (GRCm39)	missense	possibly damaging	0.46
R0839:Ppp1r12a	UTSW	10	108,034,722 (GRCm39)	missense	probably damaging	1.00
R1053:Ppp1r12a	UTSW	10	108,098,212 (GRCm39)	missense	probably damaging	1.00
R1376:Ppp1r12a	UTSW	10	108,034,779 (GRCm39)	missense	probably damaging	0.98
R1376:Ppp1r12a	UTSW	10	108,034,779 (GRCm39)	missense	probably damaging	0.98
R1511:Ppp1r12a	UTSW	10	108,087,720 (GRCm39)	missense	probably benign	0.08
R1616:Ppp1r12a	UTSW	10	108,096,728 (GRCm39)	missense	probably damaging	1.00
R1673:Ppp1r12a	UTSW	10	108,085,426 (GRCm39)	missense	probably damaging	0.96
R1866:Ppp1r12a	UTSW	10	108,098,292 (GRCm39)	missense	possibly damaging	0.85
R1901:Ppp1r12a	UTSW	10	108,034,752 (GRCm39)	missense	probably damaging	1.00
R1902:Ppp1r12a	UTSW	10	108,034,752 (GRCm39)	missense	probably damaging	1.00
R2233:Ppp1r12a	UTSW	10	108,034,780 (GRCm39)	missense	possibly damaging	0.83
R2234:Ppp1r12a	UTSW	10	108,034,780 (GRCm39)	missense	possibly damaging	0.83
R3760:Ppp1r12a	UTSW	10	108,100,595 (GRCm39)	missense	probably damaging	1.00
R3856:Ppp1r12a	UTSW	10	108,089,362 (GRCm39)	intron	probably benign
R3973:Ppp1r12a	UTSW	10	108,089,341 (GRCm39)	missense	probably benign	0.44
R3974:Ppp1r12a	UTSW	10	108,089,341 (GRCm39)	missense	probably benign	0.44
R3976:Ppp1r12a	UTSW	10	108,089,341 (GRCm39)	missense	probably benign	0.44
R4502:Ppp1r12a	UTSW	10	108,085,339 (GRCm39)	missense	probably benign	0.26
R4902:Ppp1r12a	UTSW	10	108,066,451 (GRCm39)	missense	probably damaging	1.00
R5092:Ppp1r12a	UTSW	10	108,103,263 (GRCm39)	critical splice acceptor site	probably null
R5224:Ppp1r12a	UTSW	10	108,096,886 (GRCm39)	missense	probably benign	0.37
R5353:Ppp1r12a	UTSW	10	108,097,077 (GRCm39)	splice site	probably null
R5428:Ppp1r12a	UTSW	10	108,089,208 (GRCm39)	missense	possibly damaging	0.76
R5472:Ppp1r12a	UTSW	10	108,075,973 (GRCm39)	missense	probably damaging	1.00
R5510:Ppp1r12a	UTSW	10	108,085,488 (GRCm39)	missense	possibly damaging	0.82
R6217:Ppp1r12a	UTSW	10	108,076,045 (GRCm39)	splice site	probably null
R6274:Ppp1r12a	UTSW	10	108,096,751 (GRCm39)	missense	probably benign	0.00
R6431:Ppp1r12a	UTSW	10	108,098,281 (GRCm39)	missense	probably damaging	1.00
R6744:Ppp1r12a	UTSW	10	108,066,395 (GRCm39)	missense	probably damaging	1.00
R6838:Ppp1r12a	UTSW	10	108,097,137 (GRCm39)	missense	possibly damaging	0.76
R6865:Ppp1r12a	UTSW	10	108,098,242 (GRCm39)	nonsense	probably null
R6993:Ppp1r12a	UTSW	10	108,076,698 (GRCm39)	missense	probably benign	0.18
R7565:Ppp1r12a	UTSW	10	108,104,501 (GRCm39)	missense	probably benign	0.21
R8153:Ppp1r12a	UTSW	10	107,998,303 (GRCm39)	missense	probably damaging	0.98
R8174:Ppp1r12a	UTSW	10	108,107,598 (GRCm39)	missense	probably benign	0.26
R8407:Ppp1r12a	UTSW	10	108,076,042 (GRCm39)	critical splice donor site	probably null
R8422:Ppp1r12a	UTSW	10	108,077,042 (GRCm39)	missense	probably benign
R8716:Ppp1r12a	UTSW	10	108,096,749 (GRCm39)	missense	probably damaging	1.00
R9090:Ppp1r12a	UTSW	10	108,098,224 (GRCm39)	missense	probably damaging	1.00
R9179:Ppp1r12a	UTSW	10	108,087,782 (GRCm39)	missense	probably damaging	1.00
R9271:Ppp1r12a	UTSW	10	108,098,224 (GRCm39)	missense	probably damaging	1.00
R9396:Ppp1r12a	UTSW	10	108,100,571 (GRCm39)	missense	probably damaging	1.00
R9683:Ppp1r12a	UTSW	10	108,096,747 (GRCm39)	missense	possibly damaging	0.78
X0027:Ppp1r12a	UTSW	10	108,050,284 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAACACTGCATGGTCACTGTCTG -3'
(R):5'- TGCTTTCCACAAAGAAGTAGAACTCTCC -3'

Sequencing Primer
(F):5'- ggggtgtttttggttttgttttg -3'
(R):5'- CATAGCTGAGTTGTAGTCCAAAC -3'

Posted On

2014-01-05