Mutagenetix > Incidental Mutation

Incidental Mutation 'R1136:Pex7'

95011

Institutional Source

Beutler Lab

Gene Symbol

Pex7

Ensembl Gene

ENSMUSG00000020003

Gene Name

peroxisomal biogenesis factor 7

Synonyms

peroxisome biogenesis factor 7

MMRRC Submission

039209-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.614) question?

Stock #

R1136 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

19735836-19783420 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19764434 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 170 (I170F)

Ref Sequence

ENSEMBL: ENSMUSP00000132996 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020182] [ENSMUST00000166511]

AlphaFold

P97865

Predicted Effect

probably benign
Transcript: ENSMUST00000020182
AA Change: I196F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000020182
Gene: ENSMUSG00000020003
AA Change: I196F

Domain	Start	End	E-Value	Type
WD40	52	91	9.24e-4	SMART
WD40	95	136	6.14e-9	SMART
WD40	139	179	8.55e-8	SMART
WD40	182	222	3.5e-4	SMART
WD40	226	266	1.3e-7	SMART
WD40	270	310	6.66e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166511
AA Change: I170F

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132996
Gene: ENSMUSG00000020003
AA Change: I170F

Domain	Start	End	E-Value	Type
WD40	52	91	9.24e-4	SMART
WD40	113	153	8.55e-8	SMART
WD40	156	196	3.5e-4	SMART
WD40	200	240	1.3e-7	SMART
WD40	244	284	6.66e-1	SMART

Meta Mutation Damage Score

0.5535

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic receptor for the set of peroxisomal matrix enzymes targeted to the organelle by the peroxisome targeting signal 2 (PTS2). Defects in this gene cause peroxisome biogenesis disorders (PBDs), which are characterized by multiple defects in peroxisome function. There are at least 14 complementation groups for PBDs, with more than one phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene have been associated with PBD complementation group 11 (PBD-CG11) disorders, rhizomelic chondrodysplasia punctata type 1 (RCDP1), and Refsum disease (RD). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for mutations in this gene, are petite with cataracts and have delayed ossification and fertility defects. Additionally, mice have biochemical defects in plasmalogen biosynthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	C	T	13: 68,878,436 (GRCm39)	G401S	probably damaging	Het
Akap8l	C	T	17: 32,551,457 (GRCm39)	R511H	probably damaging	Het
Bmp2	T	C	2: 133,402,847 (GRCm39)	F133L	probably damaging	Het
C1qtnf3	A	G	15: 10,978,670 (GRCm39)	E290G	probably damaging	Het
Ccdc180	C	A	4: 45,914,589 (GRCm39)	D701E	probably benign	Het
Chmp7	C	T	14: 69,956,899 (GRCm39)	M336I	probably benign	Het
Csmd3	A	T	15: 47,539,213 (GRCm39)	I1508N	probably damaging	Het
Dgkh	T	C	14: 78,862,329 (GRCm39)	R80G	probably damaging	Het
Dock1	T	A	7: 134,449,902 (GRCm39)	V805D	possibly damaging	Het
Eef2	C	CN	10: 81,014,603 (GRCm39)		probably null	Het
Ercc6l2	T	A	13: 64,016,934 (GRCm39)	V679D	possibly damaging	Het
Esp6	T	C	17: 40,876,284 (GRCm39)	Y111H	probably benign	Het
Focad	T	C	4: 88,244,417 (GRCm39)	F799S	unknown	Het
Foxred1	C	A	9: 35,116,333 (GRCm39)	M438I	probably benign	Het
Galnt11	T	G	5: 25,463,943 (GRCm39)	V405G	probably damaging	Het
Gm4847	A	G	1: 166,457,935 (GRCm39)	Y473H	probably damaging	Het
Gpbp1l1	C	T	4: 116,450,115 (GRCm39)	T461M	probably damaging	Het
Hnrnpu	A	T	1: 178,158,790 (GRCm39)		probably benign	Het
Kmt2d	A	T	15: 98,755,646 (GRCm39)		probably benign	Het
Matr3	A	G	18: 35,705,948 (GRCm39)	H291R	probably damaging	Het
Mfsd14b	C	T	13: 65,243,506 (GRCm39)	S46N	probably benign	Het
Mtch1	C	T	17: 29,552,744 (GRCm39)		probably null	Het
Muc6	G	T	7: 141,218,685 (GRCm39)	T1996N	possibly damaging	Het
Mylk	T	C	16: 34,820,688 (GRCm39)	I1880T	probably damaging	Het
N4bp2	T	C	5: 65,965,815 (GRCm39)	L1288P	probably damaging	Het
Ncf2	A	T	1: 152,706,123 (GRCm39)	H245L	probably damaging	Het
Nmd3	T	A	3: 69,654,049 (GRCm39)		probably benign	Het
Npdc1	G	T	2: 25,297,727 (GRCm39)	A127S	probably benign	Het
Nudt3	C	A	17: 27,842,080 (GRCm39)	R27L	probably benign	Het
Nwd1	C	T	8: 73,424,397 (GRCm39)		probably benign	Het
Phyhipl	A	G	10: 70,404,902 (GRCm39)	V57A	probably damaging	Het
Pkhd1	G	A	1: 20,593,053 (GRCm39)	P1687S	possibly damaging	Het
Plekhj1	A	T	10: 80,633,654 (GRCm39)		probably null	Het
Prss21	T	A	17: 24,091,968 (GRCm39)	L312H	probably damaging	Het
Samsn1	T	C	16: 75,670,408 (GRCm39)	I232V	probably null	Het
Sec63	A	T	10: 42,682,542 (GRCm39)	D411V	probably damaging	Het
Slc44a4	C	T	17: 35,146,998 (GRCm39)	H343Y	probably damaging	Het
Sucla2	C	T	14: 73,798,074 (GRCm39)		probably benign	Het
Tedc2	T	A	17: 24,435,291 (GRCm39)	E366V	probably damaging	Het
Tedc2	C	A	17: 24,435,292 (GRCm39)	E366*	probably null	Het
Tent2	C	T	13: 93,312,205 (GRCm39)		probably null	Het
Tmtc3	A	G	10: 100,307,905 (GRCm39)		probably benign	Het
Trafd1	C	T	5: 121,511,387 (GRCm39)	R477H	possibly damaging	Het
Uhrf2	T	A	19: 30,033,626 (GRCm39)		probably benign	Het
Vmn2r68	T	A	7: 84,871,549 (GRCm39)	D578V	possibly damaging	Het
Wdcp	G	A	12: 4,901,655 (GRCm39)	V504I	possibly damaging	Het
Wdr93	T	C	7: 79,423,196 (GRCm39)	Y487H	probably damaging	Het
Zfp457	T	C	13: 67,441,846 (GRCm39)	H147R	probably damaging	Het

Other mutations in Pex7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01404:Pex7	APN	10	19,770,557 (GRCm39)	intron	probably benign
IGL02833:Pex7	APN	10	19,770,500 (GRCm39)	missense	probably damaging	1.00
IGL02836:Pex7	APN	10	19,769,990 (GRCm39)	splice site	probably benign
IGL03164:Pex7	APN	10	19,770,461 (GRCm39)	intron	probably benign
plummage	UTSW	10	19,770,061 (GRCm39)	missense	probably damaging	1.00
PIT4494001:Pex7	UTSW	10	19,770,469 (GRCm39)	critical splice donor site	probably null
R0230:Pex7	UTSW	10	19,780,331 (GRCm39)	missense	possibly damaging	0.50
R2049:Pex7	UTSW	10	19,770,061 (GRCm39)	missense	probably damaging	1.00
R4977:Pex7	UTSW	10	19,745,078 (GRCm39)	missense	probably benign	0.05
R5632:Pex7	UTSW	10	19,764,483 (GRCm39)	missense	probably damaging	1.00
R6901:Pex7	UTSW	10	19,736,740 (GRCm39)	missense	probably benign	0.03
R7561:Pex7	UTSW	10	19,770,012 (GRCm39)	nonsense	probably null
R8429:Pex7	UTSW	10	19,770,074 (GRCm39)	missense	probably damaging	0.96
R8775:Pex7	UTSW	10	19,760,522 (GRCm39)	critical splice donor site	probably null
R8775-TAIL:Pex7	UTSW	10	19,760,522 (GRCm39)	critical splice donor site	probably null
R9498:Pex7	UTSW	10	19,762,859 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTAACGCAGGTCAGTCCCTTACTC -3'
(R):5'- TCTCTCTTCAGCACCAGTGCAGAC -3'

Sequencing Primer
(F):5'- GGTCAGTCCCTTACTCACAAC -3'
(R):5'- AACAGATCCTCTGAAGGCTG -3'

Posted On

2014-01-05