Incidental Mutation 'R1028:Ano8'
List |< first << previous [record 41 of 585] next >> last >|
ID95048
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Nameanoctamin 8
SynonymsTmem16h
MMRRC Submission 039130-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R1028 (G1)
Quality Score104
Status Not validated
Chromosome8
Chromosomal Location71476019-71485963 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GCCTCCTCCTCCTCCTC to GCCTCCTCCTCCTC at 71480971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093450] [ENSMUST00000124745] [ENSMUST00000138892] [ENSMUST00000147642] [ENSMUST00000213382]
Predicted Effect probably benign
Transcript: ENSMUST00000093450
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124745
SMART Domains Protein: ENSMUSP00000121042
Gene: ENSMUSG00000074247

DomainStartEndE-ValueType
Pfam:DDA1 3 65 6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135052
Predicted Effect probably benign
Transcript: ENSMUST00000138892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146677
Predicted Effect probably benign
Transcript: ENSMUST00000147642
SMART Domains Protein: ENSMUSP00000123665
Gene: ENSMUSG00000074247

DomainStartEndE-ValueType
Pfam:DDA1 3 52 1.2e-23 PFAM
low complexity region 84 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect probably benign
Transcript: ENSMUST00000213382
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 12: 105,710,189 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Cmah A G 13: 24,435,662 D171G probably damaging Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Entpd3 A G 9: 120,558,361 H208R probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Nlrp4e T C 7: 23,321,744 F552S probably damaging Het
Olfr1297 A T 2: 111,621,525 L183Q probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0282:Ano8 UTSW 8 71480614 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4161:Ano8 UTSW 8 71482637 missense probably damaging 1.00
R4192:Ano8 UTSW 8 71483292 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R5994:Ano8 UTSW 8 71484834 missense probably damaging 1.00
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 unclassified probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCTCAGCAAAGCTGACCTTCTTG -3'
(R):5'- GCGCAAAATGGGTCTTAGTGCAG -3'

Sequencing Primer
(F):5'- AAGCTGACCTTCTTGAGGCG -3'
(R):5'- CCGGGAAGGgtgtgtgtg -3'
Posted On2014-01-05