Incidental Mutation 'R1028:Ak7'
List |< first << previous [record 38 of 585] next >> last >|
ID95062
Institutional Source Beutler Lab
Gene Symbol Ak7
Ensembl Gene ENSMUSG00000041323
Gene Nameadenylate kinase 7
Synonyms4930502N02Rik
MMRRC Submission 039130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1028 (G1)
Quality Score127
Status Not validated
Chromosome12
Chromosomal Location105705976-105782447 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 105710189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040876]
Predicted Effect probably benign
Transcript: ENSMUST00000040876
SMART Domains Protein: ENSMUSP00000043145
Gene: ENSMUSG00000041323

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:ADK 431 675 1.4e-9 PFAM
Pfam:Dpy-30 679 720 3.2e-23 PFAM
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit hydrocephalus, rhinitis, sperm defects and most die before 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano8 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC 8: 71,480,971 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Cmah A G 13: 24,435,662 D171G probably damaging Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Entpd3 A G 9: 120,558,361 H208R probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Nlrp4e T C 7: 23,321,744 F552S probably damaging Het
Olfr1297 A T 2: 111,621,525 L183Q probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Ak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ak7 APN 12 105713574 missense probably benign 0.06
IGL01859:Ak7 APN 12 105745297 missense probably null
IGL01939:Ak7 APN 12 105734924 missense probably benign 0.06
IGL03233:Ak7 APN 12 105761480 missense probably damaging 1.00
drizzle UTSW 12 105742332 missense probably damaging 1.00
R0453:Ak7 UTSW 12 105716048 missense probably damaging 0.98
R0538:Ak7 UTSW 12 105766617 missense probably damaging 1.00
R0619:Ak7 UTSW 12 105733511 missense probably damaging 1.00
R0724:Ak7 UTSW 12 105710254 missense probably benign 0.00
R1112:Ak7 UTSW 12 105713572 missense probably benign
R1449:Ak7 UTSW 12 105742261 missense possibly damaging 0.72
R1523:Ak7 UTSW 12 105766608 missense probably benign 0.18
R1626:Ak7 UTSW 12 105768548 missense probably benign 0.23
R1737:Ak7 UTSW 12 105742332 missense probably damaging 1.00
R1795:Ak7 UTSW 12 105726223 nonsense probably null
R1971:Ak7 UTSW 12 105726245 missense probably damaging 0.98
R2020:Ak7 UTSW 12 105745332 splice site probably null
R2267:Ak7 UTSW 12 105747214 missense probably benign
R3918:Ak7 UTSW 12 105710256 missense probably benign 0.03
R4600:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4601:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4602:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4610:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4611:Ak7 UTSW 12 105713575 missense probably benign 0.00
R4612:Ak7 UTSW 12 105761513 missense probably damaging 1.00
R4791:Ak7 UTSW 12 105710145 missense probably benign 0.05
R5523:Ak7 UTSW 12 105741082 nonsense probably null
R5911:Ak7 UTSW 12 105726212 missense probably damaging 1.00
R6066:Ak7 UTSW 12 105733491 missense possibly damaging 0.87
R6270:Ak7 UTSW 12 105768701 missense probably benign
R6767:Ak7 UTSW 12 105766607 missense probably damaging 0.98
R6960:Ak7 UTSW 12 105710244 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAACTCTCTGCACCTGTGTCACC -3'
(R):5'- ATTTCCCATGTCCCGTCATGGAGC -3'

Sequencing Primer
(F):5'- GTGTCACCAGCTATTGAATGTC -3'
(R):5'- CTAAGGGGCTGGCACCTAAG -3'
Posted On2014-01-05