Incidental Mutation 'R1029:Tgs1'
ID95121
Institutional Source Beutler Lab
Gene Symbol Tgs1
Ensembl Gene ENSMUSG00000028233
Gene Nametrimethylguanosine synthase 1
SynonymsNcoa6ip, Pimt, D4Ertd800e
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3574875-3616619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3593471 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 453 (I453T)
Ref Sequence ENSEMBL: ENSMUSP00000054112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052712]
Predicted Effect probably damaging
Transcript: ENSMUST00000052712
AA Change: I453T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054112
Gene: ENSMUSG00000028233
AA Change: I453T

DomainStartEndE-ValueType
low complexity region 113 130 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
Pfam:Met_10 661 798 3.4e-8 PFAM
Pfam:UPF0020 667 761 4.7e-7 PFAM
Pfam:Methyltransf_18 682 819 3.7e-9 PFAM
Pfam:Methyltransf_31 683 811 4.2e-10 PFAM
Pfam:Methyltransf_15 683 837 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129964
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display complete lethality around implantation with embryonic growth arrest, impaired hatching from the zona pellucida, and increased apoptosis. Null MEFs display G2 arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Tgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Tgs1 APN 4 3591292 missense possibly damaging 0.93
IGL01154:Tgs1 APN 4 3585473 nonsense probably null
IGL01554:Tgs1 APN 4 3593632 missense probably null 0.68
IGL01613:Tgs1 APN 4 3585183 missense possibly damaging 0.92
IGL02117:Tgs1 APN 4 3585836 missense probably damaging 1.00
IGL02259:Tgs1 APN 4 3604743 missense probably damaging 0.96
IGL02697:Tgs1 APN 4 3585564 missense probably benign 0.01
IGL02814:Tgs1 APN 4 3585719 missense probably damaging 1.00
IGL02962:Tgs1 APN 4 3586181 missense probably benign 0.04
IGL03223:Tgs1 APN 4 3591322 splice site probably benign
IGL03340:Tgs1 APN 4 3604813 missense probably benign 0.44
K2124:Tgs1 UTSW 4 3595547 missense probably benign 0.00
R0189:Tgs1 UTSW 4 3593620 missense probably benign 0.08
R0708:Tgs1 UTSW 4 3586152 missense probably benign 0.07
R1446:Tgs1 UTSW 4 3604848 missense probably damaging 1.00
R1623:Tgs1 UTSW 4 3585964 missense probably benign
R1711:Tgs1 UTSW 4 3598658 missense probably damaging 1.00
R1889:Tgs1 UTSW 4 3614928 missense probably benign 0.31
R2911:Tgs1 UTSW 4 3585616 missense probably benign 0.00
R3695:Tgs1 UTSW 4 3604949 intron probably null
R4615:Tgs1 UTSW 4 3585156 missense probably damaging 1.00
R5460:Tgs1 UTSW 4 3586170 missense probably benign
R6088:Tgs1 UTSW 4 3595383 missense probably benign 0.06
R6442:Tgs1 UTSW 4 3604760 nonsense probably null
X0023:Tgs1 UTSW 4 3585912 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCCTCTTTATGGCAGTCTGCTACA -3'
(R):5'- TCTTACACACGACAAAAGGTTTCCCTGA -3'

Sequencing Primer
(F):5'- tttgcttatttggtttgttttgtttg -3'
(R):5'- ACAAAAGGTTTCCCTGAGTCCTC -3'
Posted On2014-01-05