Incidental Mutation 'R1029:1700015F17Rik'
ID95127
Institutional Source Beutler Lab
Gene Symbol 1700015F17Rik
Ensembl Gene ENSMUSG00000079666
Gene NameRIKEN cDNA 1700015F17 gene
SynonymsLOC381716
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5437827-5479143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5455919 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 121 (A121T)
Ref Sequence ENSEMBL: ENSMUSP00000111107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115447] [ENSMUST00000128151] [ENSMUST00000156282]
Predicted Effect probably benign
Transcript: ENSMUST00000115447
AA Change: A121T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111107
Gene: ENSMUSG00000079666
AA Change: A121T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128151
Predicted Effect probably benign
Transcript: ENSMUST00000156282
SMART Domains Protein: ENSMUSP00000122651
Gene: ENSMUSG00000079666

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in 1700015F17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:1700015F17Rik APN 5 5450644 makesense probably null
IGL02701:1700015F17Rik APN 5 5466623 critical splice donor site probably null
IGL02821:1700015F17Rik APN 5 5452039 nonsense probably null
R1463:1700015F17Rik UTSW 5 5452073 splice site probably benign
R1525:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1550:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1764:1700015F17Rik UTSW 5 5478943 missense possibly damaging 0.83
R1911:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1912:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1930:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1931:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R2013:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2014:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2015:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2151:1700015F17Rik UTSW 5 5478875 missense possibly damaging 0.46
R2420:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R2421:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R3056:1700015F17Rik UTSW 5 5457283 critical splice donor site probably null
R4012:1700015F17Rik UTSW 5 5478955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACACAAACAGCCACTGAAGGAT -3'
(R):5'- CCTCACCTGTGGAGAAAGTACCAACAA -3'

Sequencing Primer
(F):5'- aagggggaggaggagaaag -3'
(R):5'- GCCTTATGTTCAACAGTGATCTGAG -3'
Posted On2014-01-05