Incidental Mutation 'R1029:Ugt2b34'
ID95129
Institutional Source Beutler Lab
Gene Symbol Ugt2b34
Ensembl Gene ENSMUSG00000029260
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B34
Synonyms
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86889767-86906937 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 86904387 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 250 (S250*)
Ref Sequence ENSEMBL: ENSMUSP00000108959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031181] [ENSMUST00000113333]
Predicted Effect probably null
Transcript: ENSMUST00000031181
AA Change: S250*
SMART Domains Protein: ENSMUSP00000031181
Gene: ENSMUSG00000029260
AA Change: S250*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 529 2.4e-253 PFAM
Pfam:Glyco_tran_28_C 331 456 3.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113333
AA Change: S250*
SMART Domains Protein: ENSMUSP00000108959
Gene: ENSMUSG00000029260
AA Change: S250*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 440 5.7e-190 PFAM
Pfam:Glyco_tran_28_C 344 440 1.1e-8 PFAM
Meta Mutation Damage Score 0.6448 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Ugt2b34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ugt2b34 APN 5 86892959 missense probably damaging 1.00
IGL00498:Ugt2b34 APN 5 86901225 missense probably damaging 1.00
IGL00710:Ugt2b34 APN 5 86906589 missense probably damaging 1.00
IGL01089:Ugt2b34 APN 5 86906326 missense probably benign 0.02
IGL01090:Ugt2b34 APN 5 86893820 missense probably damaging 1.00
IGL01152:Ugt2b34 APN 5 86901203 missense probably damaging 0.99
IGL01343:Ugt2b34 APN 5 86904388 missense possibly damaging 0.93
IGL01410:Ugt2b34 APN 5 86892830 missense possibly damaging 0.77
IGL01419:Ugt2b34 APN 5 86891405 missense probably damaging 1.00
IGL01986:Ugt2b34 APN 5 86901252 missense probably benign 0.01
IGL02702:Ugt2b34 APN 5 86892891 missense probably benign 0.21
IGL02725:Ugt2b34 APN 5 86906425 missense probably benign
IGL02810:Ugt2b34 APN 5 86906524 missense probably benign 0.01
IGL03199:Ugt2b34 APN 5 86906880 missense unknown
IGL03335:Ugt2b34 APN 5 86906640 missense probably benign 0.29
IGL03355:Ugt2b34 APN 5 86906685 missense probably benign 0.01
R0624:Ugt2b34 UTSW 5 86893732 critical splice donor site probably null
R0707:Ugt2b34 UTSW 5 86892899 missense possibly damaging 0.60
R0825:Ugt2b34 UTSW 5 86906701 missense possibly damaging 0.64
R1857:Ugt2b34 UTSW 5 86904382 missense possibly damaging 0.90
R1982:Ugt2b34 UTSW 5 86906313 missense probably damaging 1.00
R2032:Ugt2b34 UTSW 5 86891272 missense probably damaging 1.00
R2133:Ugt2b34 UTSW 5 86906557 missense probably benign 0.39
R4439:Ugt2b34 UTSW 5 86892867 missense probably damaging 1.00
R4783:Ugt2b34 UTSW 5 86891473 missense probably damaging 1.00
R5046:Ugt2b34 UTSW 5 86904387 missense probably benign 0.00
R5304:Ugt2b34 UTSW 5 86892865 missense probably damaging 1.00
R5543:Ugt2b34 UTSW 5 86906701 missense probably damaging 0.99
R6235:Ugt2b34 UTSW 5 86906364 missense probably benign 0.09
R6841:Ugt2b34 UTSW 5 86892816 missense probably benign 0.01
V8831:Ugt2b34 UTSW 5 86906674 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATGTTCGAAATGCAAGGCACCAG -3'
(R):5'- AGCACACATCAAGGTTCTAGCTGC -3'

Sequencing Primer
(F):5'- GCAAGGCACCAGAAGCAAG -3'
(R):5'- ttcaaatactacacacattcaaacac -3'
Posted On2014-01-05