Incidental Mutation 'R1029:Rab7'
ID95135
Institutional Source Beutler Lab
Gene Symbol Rab7
Ensembl Gene ENSMUSG00000079477
Gene NameRAB7, member RAS oncogene family
Synonyms
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87999106-88045270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88013642 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 17 (S17P)
Ref Sequence ENSEMBL: ENSMUSP00000109230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095048] [ENSMUST00000113596] [ENSMUST00000113597] [ENSMUST00000113598] [ENSMUST00000113600] [ENSMUST00000203674] [ENSMUST00000204126]
Predicted Effect probably damaging
Transcript: ENSMUST00000095048
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092658
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113596
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109226
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113597
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109227
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113598
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109228
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113600
AA Change: S17P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109230
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203674
AA Change: S17P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145215
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
small_GTPase 6 87 3.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204126
AA Change: S17P

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145097
Gene: ENSMUSG00000079477
AA Change: S17P

DomainStartEndE-ValueType
small_GTPase 6 99 6.6e-6 SMART
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted alleles exhibit abnormal endocytosis within the visceral endoderm, failure of elongation along the primitive streak and incomplete gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Rab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0242:Rab7 UTSW 6 88005132 missense probably damaging 0.98
R0242:Rab7 UTSW 6 88005132 missense probably damaging 0.98
R2025:Rab7 UTSW 6 88004179 missense probably damaging 1.00
R2086:Rab7 UTSW 6 88012318 missense probably benign 0.08
R2177:Rab7 UTSW 6 88005081 missense probably damaging 1.00
R5047:Rab7 UTSW 6 88005223 splice site probably null
R5564:Rab7 UTSW 6 88013650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTACCCAGTTCTGCAACAC -3'
(R):5'- TGATGCCAGTAATGGACCCAGCAC -3'

Sequencing Primer
(F):5'- GGGCAGGAGACACTATTCCTATAC -3'
(R):5'- TAATGGACCCAGCACTTGAGG -3'
Posted On2014-01-05