Incidental Mutation 'R1029:Mical3'
ID95137
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1029 (G1)
Quality Score153
Status Validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120934678 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1991 (D1991G)
Ref Sequence ENSEMBL: ENSMUSP00000146544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151602
Predicted Effect probably benign
Transcript: ENSMUST00000207889
AA Change: D1991G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect unknown
Transcript: ENSMUST00000212333
AA Change: D1136G
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTCACCTCAGATGATACCCCTCAC -3'
(R):5'- AGCCGAGATTTAGGGAGCAACTGC -3'

Sequencing Primer
(F):5'- ACCTGGGGTTTTCCCACG -3'
(R):5'- CCAGCTATATGCTAGTGCTCGG -3'
Posted On2014-01-05