Incidental Mutation 'R1029:Lrfn3'
ID95139
Institutional Source Beutler Lab
Gene Symbol Lrfn3
Ensembl Gene ENSMUSG00000036957
Gene Nameleucine rich repeat and fibronectin type III domain containing 3
SynonymsSALM4, A530045B06Rik
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1029 (G1)
Quality Score178
Status Validated
Chromosome7
Chromosomal Location30355489-30362772 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30355922 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 533 (P533S)
Ref Sequence ENSEMBL: ENSMUSP00000037616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046351]
Predicted Effect probably damaging
Transcript: ENSMUST00000046351
AA Change: P533S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037616
Gene: ENSMUSG00000036957
AA Change: P533S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 27 63 7.74e-2 SMART
LRR_TYP 82 105 5.81e-2 SMART
LRR_TYP 106 129 5.06e-2 SMART
LRR_TYP 130 153 6.42e-4 SMART
LRR 158 178 9.24e1 SMART
LRR 179 202 2.67e-1 SMART
LRR 203 226 1.12e1 SMART
LRRCT 249 294 2.72e-3 SMART
IGc2 308 373 2.23e-10 SMART
FN3 423 506 4e-1 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208824
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased frequency of excitatory and inhibitory postsynaptic freuqency and synapse density, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Lrfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Lrfn3 APN 7 30355964 missense probably damaging 0.98
R0565:Lrfn3 UTSW 7 30360791 missense probably benign 0.01
R0826:Lrfn3 UTSW 7 30360251 missense probably benign 0.01
R1434:Lrfn3 UTSW 7 30355927 missense possibly damaging 0.79
R1442:Lrfn3 UTSW 7 30360044 missense probably benign 0.01
R2078:Lrfn3 UTSW 7 30360454 missense possibly damaging 0.93
R4580:Lrfn3 UTSW 7 30360042 missense probably damaging 0.99
R4883:Lrfn3 UTSW 7 30355813 missense possibly damaging 0.87
R4928:Lrfn3 UTSW 7 30360623 missense possibly damaging 0.77
R5000:Lrfn3 UTSW 7 30360380 missense possibly damaging 0.48
R5364:Lrfn3 UTSW 7 30355653 missense possibly damaging 0.91
R5732:Lrfn3 UTSW 7 30359606 missense probably benign 0.22
R5857:Lrfn3 UTSW 7 30359438 missense possibly damaging 0.94
X0064:Lrfn3 UTSW 7 30360461 missense probably benign 0.17
Z1088:Lrfn3 UTSW 7 30360201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTGAGCAATTTGGTGAGTCTG -3'
(R):5'- TTGGGTATTGGGTGACCACAGTCC -3'

Sequencing Primer
(F):5'- CAATTGGACCACAGTATGGGC -3'
(R):5'- TCCCTCAGGATGATCCCAG -3'
Posted On2014-01-05