Incidental Mutation 'R1029:Vmn2r67'
ID95145
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Namevomeronasal 2, receptor 67
SynonymsEG620672
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85136240-85155902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85136766 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 677 (T677I)
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
Predicted Effect probably damaging
Transcript: ENSMUST00000168730
AA Change: T677I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: T677I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 85151930 missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 85136919 missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 85136626 missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 85136443 missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 85151441 critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 85151655 missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 85151579 missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 85155800 missense probably benign
IGL02252:Vmn2r67 APN 7 85155800 missense probably benign
IGL02328:Vmn2r67 APN 7 85150690 missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 85136610 missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 85136743 missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 85149910 missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 85150692 missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 85151445 missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 85136724 missense probably benign
R1416:Vmn2r67 UTSW 7 85151616 missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 85152823 missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 85151805 missense probably benign
R2229:Vmn2r67 UTSW 7 85152042 missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 85136556 missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 85136974 missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 85136713 missense probably damaging 1.00
R4249:Vmn2r67 UTSW 7 85150514 splice site probably null
R4666:Vmn2r67 UTSW 7 85150623 missense probably benign
R4669:Vmn2r67 UTSW 7 85150524 missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 85136385 missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 85152245 missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 85137022 missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 85136490 missense probably damaging 1.00
R5401:Vmn2r67 UTSW 7 85136557 missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 85151815 missense probably benign 0.39
R5574:Vmn2r67 UTSW 7 85151891 missense probably benign 0.00
R5643:Vmn2r67 UTSW 7 85149943 nonsense probably null
R5914:Vmn2r67 UTSW 7 85151836 missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 85150560 missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 85149934 missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 85151916 missense probably benign
R6442:Vmn2r67 UTSW 7 85155838 missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 85136692 missense probably benign 0.07
R6701:Vmn2r67 UTSW 7 85152815 missense probably damaging 1.00
R6848:Vmn2r67 UTSW 7 85152632 missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 85152153 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATGAAAGTGATCCAGACACTGC -3'
(R):5'- AGATCCTTTGGGAAAGGCTCTGGC -3'

Sequencing Primer
(F):5'- AATGTATCAGGCAGATTCCTGGC -3'
(R):5'- CTGCATCTTCTTGAAACACAGAG -3'
Posted On2014-01-05