Incidental Mutation 'R1029:Olfr521'
ID95147
Institutional Source Beutler Lab
Gene Symbol Olfr521
Ensembl Gene ENSMUSG00000073997
Gene Nameolfactory receptor 521
SynonymsMOR101-2, GA_x6K02T2PBJ9-2443810-2444775
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99763507-99769321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99767224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 21 (I21F)
Ref Sequence ENSEMBL: ENSMUSP00000151473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098263] [ENSMUST00000219663] [ENSMUST00000220001]
Predicted Effect probably benign
Transcript: ENSMUST00000098263
AA Change: I21F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095863
Gene: ENSMUSG00000073997
AA Change: I21F

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.4e-63 PFAM
Pfam:7TM_GPCR_Srsx 40 310 7.4e-6 PFAM
Pfam:7tm_1 46 309 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219663
AA Change: I21F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000220001
AA Change: I21F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Olfr521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Olfr521 APN 7 99767972 missense possibly damaging 0.73
IGL02491:Olfr521 APN 7 99767333 missense possibly damaging 0.85
R0544:Olfr521 UTSW 7 99767660 missense probably benign
R1840:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R4709:Olfr521 UTSW 7 99767782 missense probably damaging 1.00
R5215:Olfr521 UTSW 7 99767510 missense probably damaging 1.00
R5752:Olfr521 UTSW 7 99767948 missense probably benign 0.00
R5934:Olfr521 UTSW 7 99767389 missense probably damaging 1.00
R6913:Olfr521 UTSW 7 99767717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATAGGTTGAAGGATCTGGCAC -3'
(R):5'- TAGGCCATGACCACCAGGATGAAG -3'

Sequencing Primer
(F):5'- GACAGAACCCCTGTACTTCCTTTAG -3'
(R):5'- ACAGCATCTTCGGGACAGTG -3'
Posted On2014-01-05