Incidental Mutation 'R1029:Ccdc110'
ID95149
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Namecoiled-coil domain containing 110
SynonymsLOC212392
MMRRC Submission 039131-MU
Accession Numbers

Genbank: NM_001033246; MGI: 2685018

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45934619-45944145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45941780 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 236 (F236S)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
Predicted Effect probably damaging
Transcript: ENSMUST00000095326
AA Change: F236S

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: F236S

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 45942124 missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 45940623 missense probably benign 0.07
IGL02471:Ccdc110 APN 8 45941756 missense probably benign 0.14
IGL02524:Ccdc110 APN 8 45941942 missense probably benign
IGL02887:Ccdc110 APN 8 45943184 missense probably benign 0.01
IGL03227:Ccdc110 APN 8 45941549 missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 45941822 missense probably benign 0.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0189:Ccdc110 UTSW 8 45935082 missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 45934724 splice site probably benign
R0280:Ccdc110 UTSW 8 45943450 missense probably benign 0.03
R0332:Ccdc110 UTSW 8 45942964 nonsense probably null
R0371:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0502:Ccdc110 UTSW 8 45934724 splice site probably benign
R0510:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0534:Ccdc110 UTSW 8 45935138 missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R0714:Ccdc110 UTSW 8 45943010 missense possibly damaging 0.71
R0721:Ccdc110 UTSW 8 45941989 missense probably benign
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 45941885 missense probably benign 0.22
R1340:Ccdc110 UTSW 8 45942181 missense probably benign 0.02
R1540:Ccdc110 UTSW 8 45942325 nonsense probably null
R1587:Ccdc110 UTSW 8 45941746 missense probably benign 0.01
R1602:Ccdc110 UTSW 8 45938918 missense probably benign 0.12
R1629:Ccdc110 UTSW 8 45942127 missense probably benign 0.08
R1842:Ccdc110 UTSW 8 45940568 missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 45943312 missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 45942827 missense probably benign 0.10
R2093:Ccdc110 UTSW 8 45942077 missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 45942839 missense probably benign 0.00
R3613:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 45942389 missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 45942668 missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 45943208 missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 45943400 missense probably benign 0.35
R4911:Ccdc110 UTSW 8 45942907 missense probably benign 0.00
R4923:Ccdc110 UTSW 8 45943423 missense probably benign 0.29
R5104:Ccdc110 UTSW 8 45942692 missense probably damaging 0.99
R5561:Ccdc110 UTSW 8 45940609 missense probably benign 0.02
R5966:Ccdc110 UTSW 8 45942536 missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 45943499 missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 45941770 missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 45942041 missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R6405:Ccdc110 UTSW 8 45941697 nonsense probably null
R6482:Ccdc110 UTSW 8 45942788 missense probably benign 0.00
R6815:Ccdc110 UTSW 8 45941987 missense probably benign 0.19
X0053:Ccdc110 UTSW 8 45942961 missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 45941843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGAGAACTACCGCTGATAAC -3'
(R):5'- CATGCAGTTTTGACACCGTGTCC -3'

Sequencing Primer
(F):5'- TACCGCTGATAACTCACCTCC -3'
(R):5'- AGCAGTTTGCTCACTAAGGC -3'
Posted On2014-01-05