Incidental Mutation 'R1029:Znrf1'
ID95153
Institutional Source Beutler Lab
Gene Symbol Znrf1
Ensembl Gene ENSMUSG00000033545
Gene Namezinc and ring finger 1
SynonymsZrfp1, nin283, B830022L21Rik, Rnf42
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1029 (G1)
Quality Score146
Status Validated
Chromosome8
Chromosomal Location111536097-111626030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111537354 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 72 (Y72N)
Ref Sequence ENSEMBL: ENSMUSP00000133993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095176] [ENSMUST00000166859] [ENSMUST00000168428] [ENSMUST00000171182] [ENSMUST00000172856] [ENSMUST00000173506] [ENSMUST00000173781] [ENSMUST00000174333] [ENSMUST00000174454]
Predicted Effect probably damaging
Transcript: ENSMUST00000095176
AA Change: Y72N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092799
Gene: ENSMUSG00000033545
AA Change: Y72N

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166859
SMART Domains Protein: ENSMUSP00000132939
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 84 124 2.98e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168428
AA Change: Y72N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126684
Gene: ENSMUSG00000033545
AA Change: Y72N

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171182
AA Change: Y72N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127956
Gene: ENSMUSG00000033545
AA Change: Y72N

DomainStartEndE-ValueType
RING 152 192 2.98e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172856
AA Change: Y72N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133309
Gene: ENSMUSG00000033545
AA Change: Y72N

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173481
Predicted Effect probably damaging
Transcript: ENSMUST00000173506
AA Change: Y72N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133993
Gene: ENSMUSG00000033545
AA Change: Y72N

DomainStartEndE-ValueType
RING 184 224 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173726
SMART Domains Protein: ENSMUSP00000133472
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 45 85 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173781
SMART Domains Protein: ENSMUSP00000134232
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 22 62 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174333
SMART Domains Protein: ENSMUSP00000134634
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 84 124 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174376
Predicted Effect probably benign
Transcript: ENSMUST00000174454
SMART Domains Protein: ENSMUSP00000133519
Gene: ENSMUSG00000033545

DomainStartEndE-ValueType
RING 22 62 2.98e-3 SMART
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase that plays a role in neural-cell differentiation. Overexpression of this gene causes neurite-like elongation. The encoded protein contains both a zinc finger and a RING finger motif and is localized in the endosome/lysosome compartment, indicating that it may be involved in ubiquitin-mediated protein modification, and in synaptic vessicle membranes in neurons. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Other mutations in Znrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1911:Znrf1 UTSW 8 111621601 makesense probably null
R1911:Znrf1 UTSW 8 111621612 missense possibly damaging 0.92
R3754:Znrf1 UTSW 8 111619211 missense probably damaging 1.00
R4867:Znrf1 UTSW 8 111537566 critical splice donor site probably null
R5090:Znrf1 UTSW 8 111538403 missense probably benign 0.00
R5267:Znrf1 UTSW 8 111537267 missense probably benign 0.00
R5271:Znrf1 UTSW 8 111609344 missense probably benign 0.23
R5396:Znrf1 UTSW 8 111619194 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGAACATGCATTCGGCTTGGACAG -3'
(R):5'- AGCACATTAAGAGGTTTCGGGCG -3'

Sequencing Primer
(F):5'- CGGCTTGGACAGTTTGAAATTC -3'
(R):5'- ACCACTGTGCGAGCTGAAC -3'
Posted On2014-01-05