Incidental Mutation 'R1029:Taar7a'
ID95157
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Nametrace amine-associated receptor 7A
SynonymsTaar7a, LOC215856
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23992405-23993481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23992541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 314 (I314T)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078532
AA Change: I314T

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: I314T

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23992396 unclassified probably benign
IGL02408:Taar7a APN 10 23992602 missense probably benign
R0422:Taar7a UTSW 10 23993274 missense probably benign 0.02
R1742:Taar7a UTSW 10 23993219 missense probably damaging 0.98
R2104:Taar7a UTSW 10 23993061 missense probably damaging 0.99
R2421:Taar7a UTSW 10 23992517 missense probably damaging 1.00
R3907:Taar7a UTSW 10 23992559 missense probably benign 0.25
R4021:Taar7a UTSW 10 23993386 missense probably benign 0.00
R5180:Taar7a UTSW 10 23993148 missense probably damaging 1.00
R5486:Taar7a UTSW 10 23992458 missense probably benign 0.00
R5507:Taar7a UTSW 10 23992631 missense probably damaging 0.98
R5587:Taar7a UTSW 10 23992828 missense probably benign 0.00
R5766:Taar7a UTSW 10 23993362 missense probably benign 0.01
R5861:Taar7a UTSW 10 23992439 missense probably benign
X0064:Taar7a UTSW 10 23992617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGATCCTGTCGTACTGAAACC -3'
(R):5'- ACTGCCAGGGCATCAGAAAGCTAC -3'

Sequencing Primer
(F):5'- ATGCTTGGATCACAGCTCG -3'
(R):5'- GCATCAGAAAGCTACAAGGAC -3'
Posted On2014-01-05