Incidental Mutation 'R1029:4930505A04Rik'
ID95161
Institutional Source Beutler Lab
Gene Symbol 4930505A04Rik
Ensembl Gene ENSMUSG00000040919
Gene NameRIKEN cDNA 4930505A04 gene
Synonyms
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30426006-30471827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30426177 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 230 (L230S)
Ref Sequence ENSEMBL: ENSMUSP00000045288 (fasta)
Gene Model
Predicted Effect probably damaging
Transcript: ENSMUST00000041763
AA Change: L230S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000152718
Meta Mutation Damage Score 0.0412 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in 4930505A04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:4930505A04Rik APN 11 30454843 missense possibly damaging 0.69
IGL01545:4930505A04Rik APN 11 30426228 missense probably benign 0.13
R0400:4930505A04Rik UTSW 11 30426360 missense probably benign 0.09
R1029:4930505A04Rik UTSW 11 30446389 splice site probably benign
R1585:4930505A04Rik UTSW 11 30427175 splice site probably benign
R4708:4930505A04Rik UTSW 11 30454717 missense probably damaging 0.98
R4993:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4994:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4995:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R4996:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5187:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5189:4930505A04Rik UTSW 11 30426169 missense probably damaging 0.97
R5330:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5333:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5448:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5449:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5450:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5475:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5477:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5665:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5823:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5832:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5833:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5835:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R5873:4930505A04Rik UTSW 11 30426220 nonsense probably null
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6032:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6037:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6058:4930505A04Rik UTSW 11 30426349 missense probably damaging 0.97
R6224:4930505A04Rik UTSW 11 30454815 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAGACAGAGGGAATTTGCCCACAC -3'
(R):5'- AGAAACATGGAACCTTCGTGCAGAG -3'

Sequencing Primer
(F):5'- GGAATTTGCCCACACATTCTCAG -3'
(R):5'- CCTTCGTGCAGAGAGAGATAAAAC -3'
Posted On2014-01-05