Incidental Mutation 'R1029:Tmem117'
ID95174
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Nametransmembrane protein 117
Synonyms
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94629232-95096098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95011336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 210 (T210N)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141]
Predicted Effect probably benign
Transcript: ENSMUST00000080141
AA Change: T210N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: T210N

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 95094664 missense probably benign
IGL02342:Tmem117 APN 15 95011450 missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94931884 missense probably benign 0.10
IGL02651:Tmem117 APN 15 95094561 missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94714982 missense probably benign 0.00
IGL02819:Tmem117 APN 15 94879372 splice site probably benign
IGL02881:Tmem117 APN 15 94879425 missense probably damaging 1.00
IGL02887:Tmem117 APN 15 95094775 missense probably damaging 1.00
IGL03371:Tmem117 APN 15 95011393 missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94714919 missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94714912 missense possibly damaging 0.63
R1424:Tmem117 UTSW 15 94931808 missense probably benign 0.35
R1439:Tmem117 UTSW 15 95094597 missense probably benign
R1498:Tmem117 UTSW 15 94638361 missense probably damaging 1.00
R1604:Tmem117 UTSW 15 95094544 missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94931833 missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 95094551 missense probably damaging 1.00
R3434:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R3435:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R4560:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4561:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4562:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4563:Tmem117 UTSW 15 94638154 missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 95094450 nonsense probably null
R4854:Tmem117 UTSW 15 95094688 missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94714913 missense probably damaging 0.96
R5472:Tmem117 UTSW 15 95094513 missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 95094830 missense probably benign 0.00
R5488:Tmem117 UTSW 15 95094817 frame shift probably null
R5595:Tmem117 UTSW 15 95094884 missense probably damaging 0.99
R5648:Tmem117 UTSW 15 95094772 missense possibly damaging 0.88
R5892:Tmem117 UTSW 15 94638139 missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94714958 missense probably benign 0.08
R6334:Tmem117 UTSW 15 95011443 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCCAGGGGCCACTTACCTTTTC -3'
(R):5'- AACGTGGACACTCACCTGCATC -3'

Sequencing Primer
(F):5'- GGATGCTACCATGtttattgttttg -3'
(R):5'- CCTGCATCACAATAAGGAGGTC -3'
Posted On2014-01-05