Incidental Mutation 'R1137:Rfwd3'
ID95175
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R1137 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111288242 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 326 (R326Q)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably damaging
Transcript: ENSMUST00000038739
AA Change: R326Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: R326Q

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212958
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clca4a A G 3: 144,970,685 V78A probably damaging Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kif20b T C 19: 34,937,086 probably null Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Muc1 A T 3: 89,230,438 T196S probably benign Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
PIT4468001:Rfwd3 UTSW 8 111282720 missense probably benign 0.19
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1191:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1258:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1439:Rfwd3 UTSW 8 111278288 missense probably damaging 1.00
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1580:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R5781:Rfwd3 UTSW 8 111273084 missense probably benign 0.02
R7417:Rfwd3 UTSW 8 111273069 missense probably benign 0.03
R7510:Rfwd3 UTSW 8 111280027 missense not run
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCAGGGATCGGGCATAAATGAC -3'
(R):5'- TGTTTAAGGCTCCACCTCAGACACC -3'

Sequencing Primer
(F):5'- TGACAACGATGTCACTGTGC -3'
(R):5'- Acacccccatccccacc -3'
Posted On2014-01-05