Incidental Mutation 'R1029:Hspa13'
ID95178
Institutional Source Beutler Lab
Gene Symbol Hspa13
Ensembl Gene ENSMUSG00000032932
Gene Nameheat shock protein 70 family, member 13
Synonyms1600002I10Rik, Stch, 60kDa, B230217N24Rik
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location75745431-75767104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75765237 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 25 (Y25N)
Ref Sequence ENSEMBL: ENSMUSP00000156320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046283] [ENSMUST00000114244] [ENSMUST00000232633]
Predicted Effect probably damaging
Transcript: ENSMUST00000046283
AA Change: Y25N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048817
Gene: ENSMUSG00000032932
AA Change: Y25N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 347 3.4e-79 PFAM
Pfam:HSP70 349 460 5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114244
AA Change: Y25N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109882
Gene: ENSMUSG00000032932
AA Change: Y25N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 260 1.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174952
Predicted Effect probably damaging
Transcript: ENSMUST00000232633
AA Change: Y25N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Hspa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Hspa13 APN 16 75757992 missense possibly damaging 0.86
IGL03350:Hspa13 APN 16 75757829 missense probably damaging 1.00
R0329:Hspa13 UTSW 16 75765130 missense probably damaging 1.00
R1018:Hspa13 UTSW 16 75761276 missense possibly damaging 0.56
R2043:Hspa13 UTSW 16 75758268 missense probably benign 0.01
R3404:Hspa13 UTSW 16 75758026 nonsense probably null
R3766:Hspa13 UTSW 16 75765086 missense probably benign 0.00
R4596:Hspa13 UTSW 16 75758226 missense probably benign 0.01
R4610:Hspa13 UTSW 16 75761302 missense probably benign 0.02
R4839:Hspa13 UTSW 16 75765281 missense probably damaging 1.00
R5621:Hspa13 UTSW 16 75766763 utr 5 prime probably benign
R5782:Hspa13 UTSW 16 75758097 missense probably damaging 1.00
R6428:Hspa13 UTSW 16 75757986 missense probably damaging 1.00
R6597:Hspa13 UTSW 16 75765197 missense probably damaging 1.00
R6746:Hspa13 UTSW 16 75765037 missense possibly damaging 0.89
R6903:Hspa13 UTSW 16 75757984 missense probably damaging 1.00
Z1088:Hspa13 UTSW 16 75758185 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATACACATCACCGTCCGTGAAGG -3'
(R):5'- ACATACCAAAGCTGTCTCTGTGGGAA -3'

Sequencing Primer
(F):5'- CGTGAAGGACACCATGCTG -3'
(R):5'- CCCCGATGGAATGTTAAAAACTTG -3'
Posted On2014-01-05