Incidental Mutation 'R1029:Ehd3'
ID95182
Institutional Source Beutler Lab
Gene Symbol Ehd3
Ensembl Gene ENSMUSG00000024065
Gene NameEH-domain containing 3
SynonymsEhd2
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73804841-73832093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73816326 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 108 (I108N)
Ref Sequence ENSEMBL: ENSMUSP00000024860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024860]
Predicted Effect probably benign
Transcript: ENSMUST00000024860
AA Change: I108N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024860
Gene: ENSMUSG00000024065
AA Change: I108N

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.6e-21 PFAM
Pfam:MMR_HSR1 60 220 1.7e-8 PFAM
Pfam:Dynamin_N 61 221 1.3e-12 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.95e-45 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Ehd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Ehd3 APN 17 73827489 missense probably damaging 0.99
IGL01400:Ehd3 APN 17 73828094 missense probably benign 0.06
IGL01557:Ehd3 APN 17 73805280 missense probably benign
IGL02214:Ehd3 APN 17 73820546 missense probably damaging 1.00
IGL03053:Ehd3 APN 17 73805442 missense probably damaging 0.97
IGL02796:Ehd3 UTSW 17 73816401 missense probably damaging 1.00
R0468:Ehd3 UTSW 17 73805379 missense probably damaging 1.00
R0557:Ehd3 UTSW 17 73829933 missense probably benign 0.00
R1295:Ehd3 UTSW 17 73828186 missense probably damaging 0.97
R1386:Ehd3 UTSW 17 73820543 missense probably damaging 1.00
R1796:Ehd3 UTSW 17 73830359 missense probably damaging 1.00
R3821:Ehd3 UTSW 17 73827395 missense probably benign 0.01
R4873:Ehd3 UTSW 17 73805304 missense probably damaging 1.00
R4875:Ehd3 UTSW 17 73805304 missense probably damaging 1.00
R5104:Ehd3 UTSW 17 73827447 missense probably benign 0.44
R5244:Ehd3 UTSW 17 73830000 missense probably benign
R5283:Ehd3 UTSW 17 73820503 missense probably benign
R5339:Ehd3 UTSW 17 73828207 missense possibly damaging 0.63
R5966:Ehd3 UTSW 17 73827361 missense probably damaging 1.00
R5966:Ehd3 UTSW 17 73827366 missense probably damaging 1.00
R6255:Ehd3 UTSW 17 73805413 missense probably benign 0.17
R6906:Ehd3 UTSW 17 73830338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCATGACCCAAGTATGACCAG -3'
(R):5'- CAGTTACACTCAGGCACCAGTCAAG -3'

Sequencing Primer
(F):5'- ACCTGCTGGAACAGGATTTTCC -3'
(R):5'- ACAGGGTCTCCCAGGACTAC -3'
Posted On2014-01-05