Incidental Mutation 'R1029:Gfra3'
ID95186
Institutional Source Beutler Lab
Gene Symbol Gfra3
Ensembl Gene ENSMUSG00000024366
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 3
SynonymsGFRalpha3, GFR alpha-3
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34689903-34720387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34690839 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 361 (T361A)
Ref Sequence ENSEMBL: ENSMUSP00000025224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025224]
Predicted Effect probably benign
Transcript: ENSMUST00000025224
AA Change: T361A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000025224
Gene: ENSMUSG00000024366
AA Change: T361A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
GDNF 41 122 1.33e-15 SMART
GDNF 159 236 5.57e-18 SMART
GDNF 245 337 9.84e-28 SMART
low complexity region 380 393 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the glial cell line-derived neurotrophic receptor (GDNFR) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein mediates binding of the ligand artemin to the ret receptor tyrosine kinase, and this interaction may regulate thermal pain and axon regeneration. Homozygous knockout mice for this gene exhibit impaired proliferation of cultured neuroblasts and impaired development of the superior cervical ganglion. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display ptosis and poor development of the sympathetic chain ganglia and associated nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Gfra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gfra3 APN 18 34691548 critical splice donor site probably null
IGL01778:Gfra3 APN 18 34691591 missense possibly damaging 0.65
IGL02051:Gfra3 APN 18 34695841 missense possibly damaging 0.95
R0107:Gfra3 UTSW 18 34711306 missense probably benign 0.04
R0573:Gfra3 UTSW 18 34691615 missense probably benign
R1870:Gfra3 UTSW 18 34711320 missense probably damaging 0.97
R2512:Gfra3 UTSW 18 34704511 missense probably benign 0.04
R4689:Gfra3 UTSW 18 34690587 missense unknown
R4801:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4802:Gfra3 UTSW 18 34720192 missense probably damaging 0.98
R4884:Gfra3 UTSW 18 34711251 missense probably benign 0.00
R5824:Gfra3 UTSW 18 34711211 missense probably damaging 1.00
R6111:Gfra3 UTSW 18 34690874 missense probably damaging 1.00
R6192:Gfra3 UTSW 18 34704529 missense possibly damaging 0.87
R6228:Gfra3 UTSW 18 34695793 missense probably damaging 1.00
R6251:Gfra3 UTSW 18 34695811 frame shift probably null
R6759:Gfra3 UTSW 18 34695873 nonsense probably null
R6781:Gfra3 UTSW 18 34711322 missense possibly damaging 0.56
R6894:Gfra3 UTSW 18 34695657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTAAGCCTAAGGGAAGAGTCG -3'
(R):5'- AGTCAAGCATCCATCTTCTGTGCC -3'

Sequencing Primer
(F):5'- TCGTGACTGTCCCCTTCC -3'
(R):5'- CTTGTCTAAGCCCTAAGAACTGG -3'
Posted On2014-01-05