Incidental Mutation 'R1029:Fam170a'
ID95188
Institutional Source Beutler Lab
Gene Symbol Fam170a
Ensembl Gene ENSMUSG00000035420
Gene Namefamily with sequence similarity 170, member A
SynonymsZnfd, LOC225497
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R1029 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location50278369-50283019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50281674 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 129 (V129A)
Ref Sequence ENSEMBL: ENSMUSP00000035910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039121]
Predicted Effect probably damaging
Transcript: ENSMUST00000039121
AA Change: V129A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035910
Gene: ENSMUSG00000035420
AA Change: V129A

DomainStartEndE-ValueType
low complexity region 92 105 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
ZnF_C2H2 224 244 2.35e1 SMART
low complexity region 268 300 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Fam170a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Fam170a APN 18 50281778 missense probably benign 0.00
IGL01637:Fam170a APN 18 50281667 missense possibly damaging 0.88
IGL01681:Fam170a APN 18 50282235 missense possibly damaging 0.55
IGL03151:Fam170a APN 18 50281641 missense probably damaging 1.00
IGL03263:Fam170a APN 18 50280521 splice site probably benign
R0446:Fam170a UTSW 18 50280632 missense possibly damaging 0.92
R1242:Fam170a UTSW 18 50282139 missense probably damaging 0.96
R1958:Fam170a UTSW 18 50282114 missense probably benign 0.04
R2325:Fam170a UTSW 18 50281850 missense possibly damaging 0.56
R3722:Fam170a UTSW 18 50282204 missense probably benign 0.16
R4012:Fam170a UTSW 18 50281971 missense probably damaging 1.00
R4240:Fam170a UTSW 18 50281667 missense possibly damaging 0.88
R4835:Fam170a UTSW 18 50281983 missense probably damaging 0.98
R5030:Fam170a UTSW 18 50281954 missense probably benign 0.00
R5201:Fam170a UTSW 18 50282126 missense probably benign 0.00
R5401:Fam170a UTSW 18 50280551 missense probably benign 0.20
R5907:Fam170a UTSW 18 50282254 critical splice donor site probably null
R6207:Fam170a UTSW 18 50281950 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTAATGTCACTCGTGGTCCCTC -3'
(R):5'- TGATCCCATACTGCACATGCTCTTG -3'

Sequencing Primer
(F):5'- ACCTGGAAATTGCTACAGGAC -3'
(R):5'- ATGGTCACGAGCCAGTCAG -3'
Posted On2014-01-05