Incidental Mutation 'R1029:Pak3'
ID95190
Institutional Source Beutler Lab
Gene Symbol Pak3
Ensembl Gene ENSMUSG00000031284
Gene Namep21 (RAC1) activated kinase 3
SynonymsPAK-3
MMRRC Submission 039131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1029 (G1)
Quality Score104
Status Not validated
ChromosomeX
Chromosomal Location143518591-143797796 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC at 143743893 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033640] [ENSMUST00000112863] [ENSMUST00000112864] [ENSMUST00000112865] [ENSMUST00000112868] [ENSMUST00000134402] [ENSMUST00000172330]
Predicted Effect probably benign
Transcript: ENSMUST00000033640
SMART Domains Protein: ENSMUSP00000033640
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112863
SMART Domains Protein: ENSMUSP00000108484
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112864
SMART Domains Protein: ENSMUSP00000108485
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112865
SMART Domains Protein: ENSMUSP00000108486
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112868
SMART Domains Protein: ENSMUSP00000108489
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134402
SMART Domains Protein: ENSMUSP00000119090
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 105 2.49e-9 SMART
Pfam:PBD 124 163 2e-9 PFAM
low complexity region 208 225 N/A INTRINSIC
Pfam:Pkinase 304 366 4e-10 PFAM
Pfam:Pkinase_Tyr 304 366 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172330
SMART Domains Protein: ENSMUSP00000126562
Gene: ENSMUSG00000031284

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for one knock-out allele display a selective impairment in hippocampal late-phase long-term potentiation, and deficits in learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,455,919 A121T probably benign Het
4930505A04Rik A G 11: 30,426,177 L230S probably damaging Het
4930505A04Rik A G 11: 30,446,389 probably benign Het
Atg2b A G 12: 105,635,773 I1648T probably damaging Het
Ccdc110 T C 8: 45,941,780 F236S probably damaging Het
Ccdc178 T C 18: 22,097,725 D363G possibly damaging Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Cog7 C T 7: 121,930,529 probably null Het
Dnah7c A G 1: 46,612,721 K1365E probably damaging Het
Dock9 T C 14: 121,599,684 probably null Het
Ehd3 T A 17: 73,816,326 I108N probably benign Het
Erbb4 A G 1: 68,309,614 S535P probably damaging Het
Fam170a T C 18: 50,281,674 V129A probably damaging Het
Gfra3 T C 18: 34,690,839 T361A probably benign Het
Gm10295 A T 7: 71,350,700 I44K unknown Het
Gm10553 T C 1: 85,100,449 S96P probably benign Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Hspa13 A T 16: 75,765,237 Y25N probably damaging Het
Lrfn3 G A 7: 30,355,922 P533S probably damaging Het
Lrp4 A G 2: 91,487,027 probably benign Het
Mical3 T C 6: 120,934,678 D1991G probably benign Het
Myoz1 A G 14: 20,650,532 Y206H probably damaging Het
Olfr521 A T 7: 99,767,224 I21F probably benign Het
Otog A G 7: 46,274,595 E1126G probably damaging Het
Prkdc A G 16: 15,654,749 probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sppl2a A G 2: 126,923,594 S203P probably benign Het
Taar7a A G 10: 23,992,541 I314T possibly damaging Het
Tgs1 T C 4: 3,593,471 I453T probably damaging Het
Tmem117 C A 15: 95,011,336 T210N probably benign Het
Trim55 A G 3: 19,644,742 N45S probably damaging Het
Ugt2b34 G C 5: 86,904,387 S250* probably null Het
Vmn2r67 G A 7: 85,136,766 T677I probably damaging Het
Zfp335 C G 2: 164,892,678 probably benign Het
Znrf1 T A 8: 111,537,354 Y72N probably damaging Het
Other mutations in Pak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Pak3 APN X 143789333 missense probably damaging 1.00
R0464:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0583:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0586:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0587:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0781:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0908:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1917:Pak3 UTSW X 143791302 missense possibly damaging 0.94
R2918:Pak3 UTSW X 143764976 missense probably damaging 1.00
R3801:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3802:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3803:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3804:Pak3 UTSW X 143709731 missense probably damaging 1.00
R4326:Pak3 UTSW X 143733209 splice site probably null
R4328:Pak3 UTSW X 143733209 splice site probably null
R4329:Pak3 UTSW X 143733209 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCCAGACTTCTTCATTAGACCCATC -3'
(R):5'- TGTTAGTTACCAAGCAACTCACCAGC -3'

Sequencing Primer
(F):5'- ATCCTCCTAGCATGGAACTAGTG -3'
(R):5'- TACAGAGAACAGGAGTCATGAATTG -3'
Posted On2014-01-05