Incidental Mutation 'R1033:Rpl7'
ID95193
Institutional Source Beutler Lab
Gene Symbol Rpl7
Ensembl Gene ENSMUSG00000043716
Gene Nameribosomal protein L7
SynonymsSurf-3, Rpl7a
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16101295-16104662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16102504 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 197 (I197T)
Ref Sequence ENSEMBL: ENSMUSP00000071616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053] [ENSMUST00000058437]
Predicted Effect probably benign
Transcript: ENSMUST00000027053
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058437
AA Change: I197T

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071616
Gene: ENSMUSG00000043716
AA Change: I197T

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 39 109 4.5e-31 PFAM
Pfam:Ribosomal_L30 112 162 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141217
Predicted Effect unknown
Transcript: ENSMUST00000149566
AA Change: I222T
SMART Domains Protein: ENSMUSP00000118695
Gene: ENSMUSG00000043716
AA Change: I222T

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Ribosomal_L30_N 65 135 2.1e-31 PFAM
Pfam:Ribosomal_L30 138 188 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151017
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L30P family of ribosomal proteins. It contains an N-terminal basic region-leucine zipper (BZIP)-like domain and the RNP consensus submotif RNP2. In vitro the BZIP-like domain mediates homodimerization and stable binding to DNA and RNA, with a preference for 28S rRNA and mRNA. The protein can inhibit cell-free translation of mRNAs, suggesting that it plays a regulatory role in the translation apparatus. It is located in the cytoplasm. The protein has been shown to be an autoantigen in patients with systemic autoimmune diseases, such as systemic lupus erythematosus. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Rpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Rpl7 APN 1 16102583 missense possibly damaging 0.48
R0241:Rpl7 UTSW 1 16103222 missense possibly damaging 0.57
R1447:Rpl7 UTSW 1 16102597 missense probably benign 0.01
R1586:Rpl7 UTSW 1 16102583 missense probably benign 0.02
R4809:Rpl7 UTSW 1 16101965 intron probably benign
R6511:Rpl7 UTSW 1 16103665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCAGCTAGGCTGGAATGCAAC -3'
(R):5'- TGCGGATTGTGGAGCCATACATTG -3'

Sequencing Primer
(F):5'- GTTCTGGGGAGAACCTAGC -3'
(R):5'- TGGAGCCATACATTGCATGGG -3'
Posted On2014-01-05