Incidental Mutation 'R1033:Cdh7'
ID95197
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 039132-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110085053 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 372 (D372V)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably damaging
Transcript: ENSMUST00000027542
AA Change: D372V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: D372V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112701
AA Change: D372V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: D372V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172005
AA Change: D372V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: D372V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGTGTCTGAGCTGGAAAACG -3'
(R):5'- GGAAGAAAGAAGCCCTTGATTTGTTGC -3'

Sequencing Primer
(F):5'- GAAAAGACTGTGCTTTGCTGAC -3'
(R):5'- GGCCATTATACAGAATGATGACTG -3'
Posted On2014-01-05