Incidental Mutation 'R1033:Olfr1282'
ID95209
Institutional Source Beutler Lab
Gene Symbol Olfr1282
Ensembl Gene ENSMUSG00000096554
Gene Nameolfactory receptor 1282
SynonymsMOR248-2, Olfr1557, GA_x6K02T2Q125-72387537-72386620, MOR248-16
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111335159-111336076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111335802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 92 (I92N)
Ref Sequence ENSEMBL: ENSMUSP00000097213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099618] [ENSMUST00000208176]
Predicted Effect probably damaging
Transcript: ENSMUST00000099618
AA Change: I92N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097213
Gene: ENSMUSG00000096554
AA Change: I92N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.5e-47 PFAM
Pfam:7tm_1 41 287 2.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Olfr1282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Olfr1282 APN 2 111335802 missense probably damaging 1.00
R0798:Olfr1282 UTSW 2 111335344 missense probably benign 0.16
R0932:Olfr1282 UTSW 2 111335198 missense probably benign 0.00
R0972:Olfr1282 UTSW 2 111335418 missense probably benign 0.18
R1864:Olfr1282 UTSW 2 111335707 missense possibly damaging 0.95
R1879:Olfr1282 UTSW 2 111335463 missense possibly damaging 0.61
R2343:Olfr1282 UTSW 2 111335700 missense probably damaging 1.00
R2509:Olfr1282 UTSW 2 111335731 missense probably damaging 0.98
R3620:Olfr1282 UTSW 2 111335344 missense probably benign 0.06
R5589:Olfr1282 UTSW 2 111335505 missense possibly damaging 0.46
R6487:Olfr1282 UTSW 2 111335667 missense probably benign 0.00
R6818:Olfr1282 UTSW 2 111335314 missense probably benign 0.22
R7153:Olfr1282 UTSW 2 111335901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAACCCAGGTGATGCTGACTG -3'
(R):5'- AGGGACTGTGTTCCTCAAGGCAAC -3'

Sequencing Primer
(F):5'- CCAGAGTATCAGTATTCATGCAGG -3'
(R):5'- TCCATCCTCTACCTGATGGC -3'
Posted On2014-01-05