Incidental Mutation 'R1033:Gm10471'
ID95233
Institutional Source Beutler Lab
Gene Symbol Gm10471
Ensembl Gene ENSMUSG00000073116
Gene Namepredicted gene 10471
Synonyms
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R1033 (G1)
Quality Score81
Status Not validated
Chromosome5
Chromosomal Location26082574-26089291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26089127 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 18 (K18E)
Ref Sequence ENSEMBL: ENSMUSP00000092553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094946]
Predicted Effect probably benign
Transcript: ENSMUST00000094946
AA Change: K18E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092553
Gene: ENSMUSG00000073116
AA Change: K18E

DomainStartEndE-ValueType
Pfam:Takusan 6 90 1.9e-27 PFAM
low complexity region 110 124 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Gm10471
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Gm10471 APN 5 26086493 missense possibly damaging 0.95
IGL01629:Gm10471 APN 5 26085702 missense probably damaging 0.99
IGL02804:Gm10471 APN 5 26086431 nonsense probably null
PIT4131001:Gm10471 UTSW 5 26086487 missense probably benign
PIT4131001:Gm10471 UTSW 5 26089095 missense probably damaging 1.00
PIT4142001:Gm10471 UTSW 5 26086487 missense probably benign
PIT4142001:Gm10471 UTSW 5 26089095 missense probably damaging 1.00
R4922:Gm10471 UTSW 5 26084793 missense probably damaging 0.99
R5876:Gm10471 UTSW 5 26084718 missense probably damaging 0.99
R5998:Gm10471 UTSW 5 26084706 missense probably damaging 1.00
R6022:Gm10471 UTSW 5 26084679 missense probably benign
R6189:Gm10471 UTSW 5 26085693 missense probably benign 0.02
R6928:Gm10471 UTSW 5 26085588 critical splice donor site probably null
R6978:Gm10471 UTSW 5 26086456 missense probably damaging 0.99
R7143:Gm10471 UTSW 5 26085676 missense probably benign 0.07
R7271:Gm10471 UTSW 5 26087995 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCTTAGACCCGCTGTCACTCG -3'
(R):5'- AACCCTGGCTTTGGAAGGAGGATG -3'

Sequencing Primer
(F):5'- CTTGAGGTTCATGGCATAACAGC -3'
(R):5'- AAAGGGCAGCTCAGTTTCCTATC -3'
Posted On2014-01-05