Incidental Mutation 'R1137:Akap8l'
ID95238
Institutional Source Beutler Lab
Gene Symbol Akap8l
Ensembl Gene ENSMUSG00000002625
Gene NameA kinase (PRKA) anchor protein 8-like
SynonymsNakap95
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R1137 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32321425-32350581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32332483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 511 (R511H)
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050214]
Predicted Effect probably damaging
Transcript: ENSMUST00000050214
AA Change: R511H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: R511H

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clca4a A G 3: 144,970,685 V78A probably damaging Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kif20b T C 19: 34,937,086 probably null Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Muc1 A T 3: 89,230,438 T196S probably benign Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Akap8l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Akap8l APN 17 32333097 missense possibly damaging 0.82
IGL01603:Akap8l APN 17 32345353 missense probably damaging 1.00
IGL02028:Akap8l APN 17 32338521 splice site probably null
IGL02033:Akap8l APN 17 32338272 missense probably damaging 1.00
IGL02301:Akap8l APN 17 32332926 splice site probably benign
R1136:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1192:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1277:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1279:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1703:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1705:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1706:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1727:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1763:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1774:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1796:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1954:Akap8l UTSW 17 32336736 missense possibly damaging 0.74
R2072:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2073:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2074:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2107:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2108:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2214:Akap8l UTSW 17 32338825 critical splice acceptor site probably null
R2215:Akap8l UTSW 17 32321595 missense possibly damaging 0.72
R2219:Akap8l UTSW 17 32334631 missense probably benign 0.23
R2234:Akap8l UTSW 17 32338803 missense probably damaging 1.00
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R4273:Akap8l UTSW 17 32321931 nonsense probably null
R4379:Akap8l UTSW 17 32321514 unclassified probably benign
R5061:Akap8l UTSW 17 32332894 missense probably damaging 1.00
R5337:Akap8l UTSW 17 32336394 missense possibly damaging 0.71
R5377:Akap8l UTSW 17 32321511 unclassified probably benign
R5579:Akap8l UTSW 17 32321942 missense probably damaging 1.00
R5609:Akap8l UTSW 17 32338400 missense probably damaging 1.00
R5667:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5671:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5747:Akap8l UTSW 17 32345378 missense probably damaging 0.97
R6186:Akap8l UTSW 17 32333044 missense probably benign 0.02
R6400:Akap8l UTSW 17 32336320 missense probably damaging 0.99
R6482:Akap8l UTSW 17 32345396 missense possibly damaging 0.94
R6712:Akap8l UTSW 17 32332888 missense probably damaging 1.00
V5088:Akap8l UTSW 17 32336739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATCCTTGTACACCAGGCAAC -3'
(R):5'- TTTGGCACCTGAGACTGTGATGAC -3'

Sequencing Primer
(F):5'- agccttgaacttacagagacc -3'
(R):5'- AGACTGTGATGACTGCTTTCTTC -3'
Posted On2014-01-05