Incidental Mutation 'R1033:Cped1'
ID95243
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Namecadherin-like and PC-esterase domain containing 1
SynonymsA430107O13Rik
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location21985916-22256404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22016951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 100 (V100F)
Ref Sequence ENSEMBL: ENSMUSP00000111040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115382] [ENSMUST00000115383] [ENSMUST00000153922]
Predicted Effect probably damaging
Transcript: ENSMUST00000115382
AA Change: V100F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111040
Gene: ENSMUSG00000062980
AA Change: V100F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115383
AA Change: V100F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: V100F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137437
SMART Domains Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 570 663 6.2e-12 PFAM
Pfam:PC-Esterase 753 963 1.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151315
SMART Domains Protein: ENSMUSP00000116822
Gene: ENSMUSG00000062980

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153922
AA Change: V100F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138562
Gene: ENSMUSG00000062980
AA Change: V100F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180395
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0130:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1300:Cped1 UTSW 6 22119553 missense probably benign 0.00
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6444:Cped1 UTSW 6 21986931 missense probably benign 0.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGAGCCGTTCAGTTCACCTTCAG -3'
(R):5'- ACGGGCTATGTGACTCGAAAATGC -3'

Sequencing Primer
(F):5'- GTTCTAGTGTTTCATCCCTAGAGG -3'
(R):5'- AGCAGCATTGCTCATATGTCG -3'
Posted On2014-01-05