Incidental Mutation 'R1033:Nxpe4'
ID95278
Institutional Source Beutler Lab
Gene Symbol Nxpe4
Ensembl Gene ENSMUSG00000044229
Gene Nameneurexophilin and PC-esterase domain family, member 4
Synonyms
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48162023-48400025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48393233 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 207 (F207L)
Ref Sequence ENSEMBL: ENSMUSP00000149644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093853] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect probably damaging
Transcript: ENSMUST00000093853
AA Change: F207L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091375
Gene: ENSMUSG00000044229
AA Change: F207L

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Neurexophilin 74 272 8.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215780
AA Change: F207L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216998
AA Change: F207L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217002
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Nxpe4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nxpe4 APN 9 48394140 missense possibly damaging 0.63
IGL01723:Nxpe4 APN 9 48398598 missense probably benign 0.00
IGL03008:Nxpe4 APN 9 48393438 missense probably benign 0.01
IGL03022:Nxpe4 APN 9 48393248 missense probably damaging 0.99
IGL03271:Nxpe4 APN 9 48393045 missense probably damaging 0.99
R0633:Nxpe4 UTSW 9 48396597 missense probably benign
R1186:Nxpe4 UTSW 9 48393392 missense probably benign 0.23
R1296:Nxpe4 UTSW 9 48396493 missense probably benign 0.00
R1596:Nxpe4 UTSW 9 48396555 missense probably damaging 0.97
R1813:Nxpe4 UTSW 9 48393378 missense possibly damaging 0.87
R2511:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R2902:Nxpe4 UTSW 9 48394146 missense probably benign 0.00
R4229:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4230:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4231:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4233:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4236:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4296:Nxpe4 UTSW 9 48398984 missense probably damaging 0.98
R5016:Nxpe4 UTSW 9 48392885 missense probably benign 0.12
R5644:Nxpe4 UTSW 9 48392750 missense probably benign 0.00
R5797:Nxpe4 UTSW 9 48396538 missense possibly damaging 0.86
R5979:Nxpe4 UTSW 9 48396562 missense probably benign 0.02
R6170:Nxpe4 UTSW 9 48392804 missense probably benign 0.12
R6208:Nxpe4 UTSW 9 48393378 missense probably benign 0.12
R6431:Nxpe4 UTSW 9 48392845 missense probably damaging 0.99
X0062:Nxpe4 UTSW 9 48399025 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGACAGACTTCAACAATGGCAC -3'
(R):5'- GACGAAATTACCACTTCCACCTCGG -3'

Sequencing Primer
(F):5'- AATGGCACTTACCTCGTCAG -3'
(R):5'- CTTCCACCTCGGAAATGTGAAATG -3'
Posted On2014-01-05