Incidental Mutation 'R1033:Frk'
ID95285
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Namefyn-related kinase
SynonymsGTK, BSK/IYK
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location34483399-34611278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34608458 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 476 (C476R)
Ref Sequence ENSEMBL: ENSMUSP00000130289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
Predicted Effect probably damaging
Transcript: ENSMUST00000019913
AA Change: C476R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: C476R

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170771
AA Change: C476R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: C476R

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215594
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34484243 missense probably damaging 0.98
IGL01402:Frk APN 10 34547385 missense probably damaging 1.00
IGL02197:Frk APN 10 34484334 missense probably damaging 1.00
IGL02289:Frk APN 10 34484366 missense probably damaging 0.99
IGL02618:Frk APN 10 34583964 missense possibly damaging 0.88
IGL02885:Frk APN 10 34484071 missense probably benign 0.03
IGL03256:Frk APN 10 34607842 missense probably benign 0.00
R0299:Frk UTSW 10 34484371 critical splice donor site probably null
R0697:Frk UTSW 10 34607837 missense probably benign 0.12
R1583:Frk UTSW 10 34591810 critical splice acceptor site probably null
R1793:Frk UTSW 10 34607882 missense probably benign 0.05
R2248:Frk UTSW 10 34608531 missense probably benign 0.10
R3084:Frk UTSW 10 34607954 missense probably damaging 1.00
R3086:Frk UTSW 10 34607954 missense probably damaging 1.00
R3765:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3766:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3906:Frk UTSW 10 34584056 missense probably benign 0.00
R4163:Frk UTSW 10 34591872 missense probably damaging 0.98
R4486:Frk UTSW 10 34608381 missense probably benign 0.10
R4591:Frk UTSW 10 34605833 missense probably benign 0.03
R4821:Frk UTSW 10 34484237 missense probably benign 0.01
R5070:Frk UTSW 10 34484284 nonsense probably null
R6172:Frk UTSW 10 34591965 missense probably damaging 1.00
R6572:Frk UTSW 10 34583967 missense probably benign 0.00
R6619:Frk UTSW 10 34605839 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GAGGCTGACCATTCCATGTTCCTG -3'
(R):5'- TGGACTGATGAGCCCCACGTTTTC -3'

Sequencing Primer
(F):5'- CTTATAGACAAGACTTGCTGCTGG -3'
(R):5'- GATGAGCCCCACGTTTTCATATC -3'
Posted On2014-01-05