Incidental Mutation 'R1138:Dnajc22'
ID95317
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene NameDnaJ heat shock protein family (Hsp40) member C22
Synonyms2810451A06Rik
MMRRC Submission 039211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1138 (G1)
Quality Score119
Status Not validated
Chromosome15
Chromosomal Location99093170-99104737 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) AGACACT to A at 99104427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
Predicted Effect probably benign
Transcript: ENSMUST00000061295
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146173
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik C T 18: 34,580,244 V258I probably benign Het
Abca4 T A 3: 122,173,848 N974K probably benign Het
Bub1b C T 2: 118,623,089 T467I probably benign Het
Bzw1 T C 1: 58,401,386 Y173H probably damaging Het
Chl1 A G 6: 103,693,179 D526G probably benign Het
Dstyk A G 1: 132,463,486 N920S probably benign Het
Glra3 A G 8: 56,088,976 probably null Het
Hpgd G A 8: 56,307,677 M136I probably benign Het
Igfbp2 A G 1: 72,849,098 D133G probably damaging Het
Lin54 A G 5: 100,444,134 M642T probably damaging Het
Map7d1 T C 4: 126,242,119 T99A possibly damaging Het
Mfsd4b5 C T 10: 39,975,154 C35Y probably damaging Het
Mycbp2 G T 14: 103,174,826 N2570K possibly damaging Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Oacyl T A 18: 65,725,450 L209Q probably damaging Het
Olfr1233 T C 2: 89,340,090 I71V probably benign Het
Pkd1 C A 17: 24,586,032 N3218K probably damaging Het
Scyl3 A G 1: 163,933,665 N46S possibly damaging Het
Sh2d3c G T 2: 32,749,405 R349L probably benign Het
Siae G A 9: 37,642,692 R366H probably damaging Het
Tmem108 T C 9: 103,498,969 N427S possibly damaging Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 99101178 missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 99101579 missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 99101005 missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 99101000 missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 99101522 missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
R1628:Dnajc22 UTSW 15 99100936 start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 99101233 missense probably benign 0.06
R2146:Dnajc22 UTSW 15 99104383 missense probably benign 0.04
R4342:Dnajc22 UTSW 15 99104464 nonsense probably null
R4950:Dnajc22 UTSW 15 99101734 missense probably benign 0.29
R7123:Dnajc22 UTSW 15 99101204 missense possibly damaging 0.89
R7173:Dnajc22 UTSW 15 99101306 missense probably benign 0.06
V7580:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7581:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7582:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCTGGGCCATTCTAGTTCTAAGG -3'
(R):5'- CAGCCTCCTAACTGAGTGCTGAAG -3'

Sequencing Primer
(F):5'- GCCATTCTAGTTCTAAGGAGCTTG -3'
(R):5'- CTAGGATTCCGTGGTATAGCC -3'
Posted On2014-01-05