Incidental Mutation 'R1033:Itgb7'
ID95332
Institutional Source Beutler Lab
Gene Symbol Itgb7
Ensembl Gene ENSMUSG00000001281
Gene Nameintegrin beta 7
Synonyms
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102215995-102231944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102223554 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 198 (D198V)
Ref Sequence ENSEMBL: ENSMUSP00000001327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000127014] [ENSMUST00000230652]
Predicted Effect probably damaging
Transcript: ENSMUST00000001327
AA Change: D198V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281
AA Change: D198V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127014
SMART Domains Protein: ENSMUSP00000123227
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PSI 48 85 4.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230652
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Itgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Itgb7 APN 15 102227585 missense probably benign 0.22
IGL01574:Itgb7 APN 15 102227540 missense possibly damaging 0.83
IGL01814:Itgb7 APN 15 102223417 missense possibly damaging 0.78
IGL01875:Itgb7 APN 15 102217995 missense probably damaging 1.00
IGL01996:Itgb7 APN 15 102217977 missense probably damaging 1.00
IGL02320:Itgb7 APN 15 102224337 missense probably benign 0.04
IGL02541:Itgb7 APN 15 102223457 missense probably benign 0.05
IGL02547:Itgb7 APN 15 102218510 missense probably damaging 1.00
R0083:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0108:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0195:Itgb7 UTSW 15 102222183 unclassified probably benign
R1627:Itgb7 UTSW 15 102223476 missense probably damaging 0.97
R1999:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2150:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2331:Itgb7 UTSW 15 102223548 missense probably damaging 1.00
R3747:Itgb7 UTSW 15 102222777 missense probably damaging 1.00
R4758:Itgb7 UTSW 15 102216207 missense probably benign 0.07
R4779:Itgb7 UTSW 15 102224413 missense possibly damaging 0.54
R5134:Itgb7 UTSW 15 102217407 missense probably damaging 1.00
R5158:Itgb7 UTSW 15 102217029 missense probably benign 0.05
R5323:Itgb7 UTSW 15 102231624 intron probably benign
R5416:Itgb7 UTSW 15 102217309 missense probably benign 0.00
R5652:Itgb7 UTSW 15 102216203 missense possibly damaging 0.48
R6089:Itgb7 UTSW 15 102217286 missense probably benign 0.00
R6144:Itgb7 UTSW 15 102223482 missense probably benign 0.45
R6384:Itgb7 UTSW 15 102224451 missense probably benign 0.04
R6475:Itgb7 UTSW 15 102216266 missense probably benign 0.12
R6754:Itgb7 UTSW 15 102216160 makesense probably null
R6857:Itgb7 UTSW 15 102223465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACAACAGGTAGTCCTGGCCCC -3'
(R):5'- GTTTCTACACCCTTGACCCTGGATG -3'

Sequencing Primer
(F):5'- TATCTCACCTGGCAGAGGG -3'
(R):5'- AAGCCTGGATGCTGCTG -3'
Posted On2014-01-05