Incidental Mutation 'R1139:4930438A08Rik'
ID95396
Institutional Source Beutler Lab
Gene Symbol 4930438A08Rik
Ensembl Gene ENSMUSG00000069873
Gene NameRIKEN cDNA 4930438A08 gene
Synonyms
MMRRC Submission 039212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1139 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58274799-58294289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58288286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 149 (V149M)
Ref Sequence ENSEMBL: ENSMUSP00000147249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108834] [ENSMUST00000208022]
Predicted Effect probably damaging
Transcript: ENSMUST00000108834
AA Change: V149M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104462
Gene: ENSMUSG00000069873
AA Change: V149M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pyr_redox_2 29 166 2e-8 PFAM
Pfam:AlaDh_PNT_C 48 124 8.8e-8 PFAM
Pfam:FAD_binding_3 61 98 1.9e-7 PFAM
Pfam:HI0933_like 62 103 3.1e-8 PFAM
Pfam:Pyr_redox 63 105 1.8e-7 PFAM
Pfam:FAD_binding_2 63 119 8.7e-9 PFAM
Pfam:DAO 63 212 2.9e-8 PFAM
Pfam:NAD_binding_8 66 133 7.1e-15 PFAM
Pfam:Amino_oxidase 71 270 7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208022
AA Change: V149M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,682,665 I1145L probably benign Het
Abcc4 A G 14: 118,500,840 M1166T possibly damaging Het
Adgra3 A T 5: 49,961,755 probably null Het
Alox12b A T 11: 69,164,405 Q334L probably damaging Het
Bod1l A T 5: 41,831,471 M431K possibly damaging Het
Ckap5 A G 2: 91,581,143 N966D probably benign Het
Csmd3 C G 15: 47,695,836 D2240H probably damaging Het
Erbin A G 13: 103,884,253 F66S probably damaging Het
Mrgprh A T 17: 12,876,942 N23I probably benign Het
Mst1r G T 9: 107,919,969 D1346Y possibly damaging Het
Nfe2l2 A G 2: 75,676,886 M290T probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr659 A G 7: 104,670,891 Y63C probably damaging Het
Olfr681 A G 7: 105,121,973 Y172C probably damaging Het
Olfr827 T C 10: 130,211,079 H17R possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rpgrip1 A C 14: 52,147,221 E757D probably benign Het
Scn9a T G 2: 66,504,997 K1207T probably benign Het
Ssb A G 2: 69,866,576 T87A possibly damaging Het
Tfdp1 C T 8: 13,373,000 R302C probably benign Het
Thbs4 T C 13: 92,774,718 Y319C probably damaging Het
Tiam2 C A 17: 3,477,267 Q67K possibly damaging Het
Tox3 A G 8: 90,248,869 L378P probably damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vcpip1 A T 1: 9,746,723 H478Q probably damaging Het
Vmn2r124 T C 17: 18,073,790 I713T possibly damaging Het
Other mutations in 4930438A08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02884:4930438A08Rik APN 11 58287476 missense probably benign 0.01
IGL03088:4930438A08Rik APN 11 58293384 missense unknown
R0715:4930438A08Rik UTSW 11 58288350 missense probably damaging 1.00
R1833:4930438A08Rik UTSW 11 58288388 nonsense probably null
R5906:4930438A08Rik UTSW 11 58291434 splice site probably null
R6056:4930438A08Rik UTSW 11 58293638 missense probably damaging 0.96
R6288:4930438A08Rik UTSW 11 58293595 missense probably damaging 1.00
R6981:4930438A08Rik UTSW 11 58293718 unclassified probably benign
R6989:4930438A08Rik UTSW 11 58287402 missense possibly damaging 0.88
R7195:4930438A08Rik UTSW 11 58288416 critical splice donor site probably null
R7344:4930438A08Rik UTSW 11 58291447 missense
Predicted Primers PCR Primer
(F):5'- TTGGTGAATCCAAGGCGGACAG -3'
(R):5'- GAGGTTGACTCAAAGCTCTTCCCTG -3'

Sequencing Primer
(F):5'- CGGACAGGAAGTAAGCCC -3'
(R):5'- TGTTTCTGCAAGGTGGCTC -3'
Posted On2014-01-05