Incidental Mutation 'R1034:Srgap1'
ID95440
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1034 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121785445 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1071 (P1071S)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
Predicted Effect probably benign
Transcript: ENSMUST00000020322
AA Change: P1048S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: P1048S

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081688
AA Change: P1071S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: P1071S

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188932
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAGTTATAAGCGCAAGACCAAGG -3'
(R):5'- TAGAGTCAACCCAGATGCACGAGG -3'

Sequencing Primer
(F):5'- GAAGGTTGTGGATCACCCACTC -3'
(R):5'- GAGACCATGAACACTGCTTTG -3'
Posted On2014-01-05