Mutagenetix > Incidental Mutation

Incidental Mutation 'R1120:Nup98'

95500

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

039193-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1120 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101768607-101859359 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101809923 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 536 (T536S)

Ref Sequence

ENSEMBL: ENSMUSP00000147445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000070165
AA Change: T536S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T536S

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000210682
AA Change: T536S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211005
AA Change: T536S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211022
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211235
AA Change: T519S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000211764

Meta Mutation Damage Score

0.0947

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	G	5: 24,613,818 (GRCm39)		probably null	Het
Akp3	A	T	1: 87,053,159 (GRCm39)	Q77L	probably damaging	Het
Blm	A	G	7: 80,131,214 (GRCm39)	L878S	probably damaging	Het
Cabin1	A	G	10: 75,561,550 (GRCm39)	Y984H	probably damaging	Het
Cadps2	T	C	6: 23,838,793 (GRCm39)	Q86R	probably damaging	Het
Cd2	C	T	3: 101,194,804 (GRCm39)	D95N	probably damaging	Het
Cd36	A	G	5: 17,990,826 (GRCm39)	I438T	possibly damaging	Het
Crhbp	G	T	13: 95,578,593 (GRCm39)	T176K	probably benign	Het
D630045J12Rik	G	T	6: 38,171,705 (GRCm39)	T821K	probably damaging	Het
Disp1	T	C	1: 182,880,139 (GRCm39)	D288G	probably benign	Het
Dsc3	A	G	18: 20,120,034 (GRCm39)	V208A	probably benign	Het
Eef1e1	A	T	13: 38,842,910 (GRCm39)	N20K	probably damaging	Het
Ercc5	A	G	1: 44,201,001 (GRCm39)	D187G	probably damaging	Het
Etl4	T	A	2: 20,811,514 (GRCm39)	M1199K	probably benign	Het
Fnbp1	A	T	2: 30,926,606 (GRCm39)	Y433N	probably damaging	Het
Fxyd3	A	G	7: 30,770,803 (GRCm39)		probably benign	Het
Hfm1	A	T	5: 107,052,084 (GRCm39)		probably benign	Het
Irak2	T	A	6: 113,652,720 (GRCm39)		probably benign	Het
Jpt2	T	C	17: 25,179,585 (GRCm39)	M1V	probably null	Het
Knl1	A	G	2: 118,892,856 (GRCm39)	R51G	probably damaging	Het
Krtap8-1	A	G	16: 89,284,753 (GRCm39)	Y15H	probably benign	Het
Lrba	A	T	3: 86,202,499 (GRCm39)	D250V	probably damaging	Het
Mgat4a	A	G	1: 37,491,662 (GRCm39)	S357P	probably damaging	Het
Or4a27	A	G	2: 88,559,281 (GRCm39)	Y221H	probably damaging	Het
Or4c109	A	G	2: 88,818,423 (GRCm39)	M41T	possibly damaging	Het
Or9k2	A	G	10: 129,998,406 (GRCm39)	L263P	probably damaging	Het
Parp14	G	A	16: 35,677,130 (GRCm39)	A946V	probably benign	Het
Pnpla8	A	G	12: 44,351,730 (GRCm39)	T568A	possibly damaging	Het
Ptprn	A	G	1: 75,234,825 (GRCm39)	I254T	probably benign	Het
Rab5b	A	C	10: 128,515,483 (GRCm39)	N188K	probably benign	Het
Samd5	A	G	10: 9,504,792 (GRCm39)	V154A	possibly damaging	Het
Smarcb1	A	G	10: 75,757,157 (GRCm39)	F25L	probably benign	Het
Smchd1	A	T	17: 71,665,141 (GRCm39)	Y1847*	probably null	Het
Smpd4	T	C	16: 17,456,350 (GRCm39)		probably benign	Het
Tex14	T	A	11: 87,429,502 (GRCm39)		probably benign	Het
Tnfrsf26	G	A	7: 143,171,651 (GRCm39)	R101C	probably damaging	Het
Trmu	A	G	15: 85,774,486 (GRCm39)	K37E	possibly damaging	Het
Tsen54	C	T	11: 115,705,839 (GRCm39)	A52V	probably damaging	Het
Ubb	T	C	11: 62,443,009 (GRCm39)	I13T	possibly damaging	Het
Vmn2r101	A	T	17: 19,797,723 (GRCm39)		probably benign	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	101,844,194 (GRCm39)	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	101,803,178 (GRCm39)	missense	probably benign
IGL00798:Nup98	APN	7	101,796,411 (GRCm39)	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	101,835,125 (GRCm39)	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	101,843,918 (GRCm39)	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	101,832,693 (GRCm39)	missense	probably benign	0.37
IGL02490:Nup98	APN	7	101,801,573 (GRCm39)	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	101,832,752 (GRCm39)	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	101,784,171 (GRCm39)	missense	probably benign	0.00
R0040:Nup98	UTSW	7	101,841,241 (GRCm39)	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	101,788,859 (GRCm39)	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	101,801,635 (GRCm39)	missense	probably null
R0471:Nup98	UTSW	7	101,788,004 (GRCm39)	missense	probably benign	0.13
R0538:Nup98	UTSW	7	101,835,892 (GRCm39)	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	101,801,660 (GRCm39)	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1469:Nup98	UTSW	7	101,788,008 (GRCm39)	missense	probably benign	0.00
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	101,796,513 (GRCm39)	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	101,784,087 (GRCm39)	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.03
R1889:Nup98	UTSW	7	101,809,923 (GRCm39)	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	101,829,631 (GRCm39)	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	101,834,084 (GRCm39)	missense	probably benign	0.03
R4361:Nup98	UTSW	7	101,794,921 (GRCm39)	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	101,834,038 (GRCm39)	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	101,802,403 (GRCm39)	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	101,845,007 (GRCm39)	missense	unknown
R4924:Nup98	UTSW	7	101,784,185 (GRCm39)	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5069:Nup98	UTSW	7	101,794,862 (GRCm39)	missense	probably benign	0.00
R5233:Nup98	UTSW	7	101,845,029 (GRCm39)	missense	unknown
R5779:Nup98	UTSW	7	101,801,568 (GRCm39)	missense	probably benign
R5922:Nup98	UTSW	7	101,803,224 (GRCm39)	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	101,829,636 (GRCm39)	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6039:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R6343:Nup98	UTSW	7	101,843,957 (GRCm39)	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	101,825,522 (GRCm39)	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	101,844,223 (GRCm39)	missense	probably benign	0.03
R6577:Nup98	UTSW	7	101,778,053 (GRCm39)	splice site	probably null
R6900:Nup98	UTSW	7	101,835,169 (GRCm39)	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	101,844,248 (GRCm39)	missense	unknown
R7218:Nup98	UTSW	7	101,841,107 (GRCm39)	splice site	probably null
R7235:Nup98	UTSW	7	101,774,491 (GRCm39)	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	101,784,002 (GRCm39)	missense	probably benign
R7402:Nup98	UTSW	7	101,784,144 (GRCm39)	missense	probably benign	0.00
R7427:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7428:Nup98	UTSW	7	101,784,208 (GRCm39)	splice site	probably null
R7584:Nup98	UTSW	7	101,825,596 (GRCm39)	missense	probably benign	0.02
R7646:Nup98	UTSW	7	101,803,242 (GRCm39)	missense	probably benign	0.01
R7648:Nup98	UTSW	7	101,773,404 (GRCm39)	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	101,802,464 (GRCm39)	splice site	probably null
R7827:Nup98	UTSW	7	101,773,569 (GRCm39)	missense	probably benign	0.10
R7884:Nup98	UTSW	7	101,825,556 (GRCm39)	missense	probably benign	0.12
R7943:Nup98	UTSW	7	101,844,029 (GRCm39)	missense	probably benign	0.10
R8034:Nup98	UTSW	7	101,794,930 (GRCm39)	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	101,835,859 (GRCm39)	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	101,783,895 (GRCm39)	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	101,844,173 (GRCm39)	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9148:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9223:Nup98	UTSW	7	101,834,167 (GRCm39)	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9249:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9272:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9274:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9283:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9326:Nup98	UTSW	7	101,788,037 (GRCm39)	missense	probably benign	0.02
R9466:Nup98	UTSW	7	101,818,611 (GRCm39)	missense	probably benign	0.05
R9492:Nup98	UTSW	7	101,778,252 (GRCm39)	missense	probably benign	0.11
R9661:Nup98	UTSW	7	101,782,019 (GRCm39)	nonsense	probably null
T0970:Nup98	UTSW	7	101,835,959 (GRCm39)	unclassified	probably benign
X0054:Nup98	UTSW	7	101,796,415 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTTAGGCATGAATGCTCCGTTG -3'
(R):5'- TGGTAAGATGTGAGTCACTGGCCC -3'

Sequencing Primer
(F):5'- AATGCTCCGTTGGCTAGAG -3'
(R):5'- TTGCTAAATAGACATGGCAGGTC -3'

Posted On

2014-01-05