Incidental Mutation 'R1120:Parp14'
ID95558
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 039193-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R1120 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35856760 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 946 (A946V)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: A946V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: A946V

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142946
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T G 5: 24,408,820 probably null Het
Akp3 A T 1: 87,125,437 Q77L probably damaging Het
Blm A G 7: 80,481,466 L878S probably damaging Het
Cabin1 A G 10: 75,725,716 Y984H probably damaging Het
Cadps2 T C 6: 23,838,794 Q86R probably damaging Het
Cd2 C T 3: 101,287,488 D95N probably damaging Het
Cd36 A G 5: 17,785,828 I438T possibly damaging Het
Crhbp G T 13: 95,442,085 T176K probably benign Het
D630045J12Rik G T 6: 38,194,770 T821K probably damaging Het
Disp1 T C 1: 183,098,575 D288G probably benign Het
Dsc3 A G 18: 19,986,977 V208A probably benign Het
Eef1e1 A T 13: 38,658,934 N20K probably damaging Het
Ercc5 A G 1: 44,161,841 D187G probably damaging Het
Etl4 T A 2: 20,806,703 M1199K probably benign Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Fxyd3 A G 7: 31,071,378 probably benign Het
Hfm1 A T 5: 106,904,218 probably benign Het
Irak2 T A 6: 113,675,759 probably benign Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Knl1 A G 2: 119,062,375 R51G probably damaging Het
Krtap8-1 A G 16: 89,487,865 Y15H probably benign Het
Lrba A T 3: 86,295,192 D250V probably damaging Het
Mgat4a A G 1: 37,452,581 S357P probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1197 A G 2: 88,728,937 Y221H probably damaging Het
Olfr1214 A G 2: 88,988,079 M41T possibly damaging Het
Olfr825 A G 10: 130,162,537 L263P probably damaging Het
Pnpla8 A G 12: 44,304,947 T568A possibly damaging Het
Ptprn A G 1: 75,258,181 I254T probably benign Het
Rab5b A C 10: 128,679,614 N188K probably benign Het
Samd5 A G 10: 9,629,048 V154A possibly damaging Het
Smarcb1 A G 10: 75,921,323 F25L probably benign Het
Smchd1 A T 17: 71,358,146 Y1847* probably null Het
Smpd4 T C 16: 17,638,486 probably benign Het
Tex14 T A 11: 87,538,676 probably benign Het
Tnfrsf26 G A 7: 143,617,914 R101C probably damaging Het
Trmu A G 15: 85,890,285 K37E possibly damaging Het
Tsen54 C T 11: 115,815,013 A52V probably damaging Het
Ubb T C 11: 62,552,183 I13T possibly damaging Het
Vmn2r101 A T 17: 19,577,461 probably benign Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCGTAGCATTCTGCACGCC -3'
(R):5'- AAGCATATCAGCGGTCTCGCAC -3'

Sequencing Primer
(F):5'- TCTACCAGGCGGATTCTCAG -3'
(R):5'- GCTGTTATCTCAAAAGCAGGC -3'
Posted On2014-01-05