Incidental Mutation 'R1005:Mc3r'
ID95597
Institutional Source Beutler Lab
Gene Symbol Mc3r
Ensembl Gene ENSMUSG00000038537
Gene Namemelanocortin 3 receptor
Synonyms
MMRRC Submission 039115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1005 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172248492-172251114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172249563 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 235 (H235R)
Ref Sequence ENSEMBL: ENSMUSP00000047358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038532]
Predicted Effect probably benign
Transcript: ENSMUST00000038532
AA Change: H235R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047358
Gene: ENSMUSG00000038537
AA Change: H235R

DomainStartEndE-ValueType
Pfam:7tm_4 45 198 3.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 49 314 1.9e-7 PFAM
Pfam:7tm_1 55 299 5.4e-35 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis and adaptation to food restriction. Disruption of this gene results in an increased ratio of weight gain to food intake, increased fat mass, and decreased lean mass, without having a large effect on insulin sensitivity or glucose metabolism. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele exhibit obesity, increased respiratory quotient on a high fat diet, and reduced energy expenditure. Homozygotes for another null allele show reduced lean mass, increased fat mass, diet-induced obesity, increased insulin and leptin levels, and reduced energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,665,514 D163G probably benign Het
Adck1 G A 12: 88,402,102 V117M probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa6 A T 11: 55,001,218 M304K possibly damaging Het
Aox1 A G 1: 58,065,352 T563A probably benign Het
AW551984 G A 9: 39,593,733 Q488* probably null Het
Cbx2 A G 11: 119,028,574 R322G probably benign Het
Csmd1 T A 8: 16,288,693 T467S probably damaging Het
Cspg4 A G 9: 56,888,736 I1252V probably benign Het
Enah A T 1: 181,961,930 probably benign Het
Fam171a2 T C 11: 102,440,181 M185V probably benign Het
Flt1 G T 5: 147,681,885 N213K probably damaging Het
Fpr-rs3 T C 17: 20,624,084 N265S probably benign Het
Gbp2 T C 3: 142,630,501 probably benign Het
Gm6871 A T 7: 41,546,258 C352S probably damaging Het
Gm9742 T C 13: 8,035,215 noncoding transcript Het
Iars T C 13: 49,687,445 I18T possibly damaging Het
Kel T C 6: 41,688,617 Y523C probably damaging Het
Klk1b8 T A 7: 43,954,334 C198* probably null Het
Nr0b2 G T 4: 133,553,474 R17L probably benign Het
Olfr43 A G 11: 74,207,136 F27L probably benign Het
Prl7a1 G A 13: 27,642,446 P2L possibly damaging Het
Prrt3 G A 6: 113,494,778 A811V probably damaging Het
Rab28 A G 5: 41,698,383 probably benign Het
Rhobtb2 A G 14: 69,798,277 L115P probably damaging Het
Robo4 A G 9: 37,408,251 E599G probably damaging Het
Ros1 T A 10: 52,128,405 probably benign Het
Slc22a27 A T 19: 7,926,751 L7Q probably damaging Het
Slfn5 T A 11: 82,960,158 L427H probably damaging Het
Smarcad1 C T 6: 65,108,727 H890Y probably benign Het
Snx31 A G 15: 36,517,691 probably benign Het
Sptb C T 12: 76,601,859 probably null Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ston2 T C 12: 91,648,848 D262G possibly damaging Het
Trank1 T G 9: 111,333,721 M16R probably benign Het
Trrap A G 5: 144,805,727 E1385G probably damaging Het
Ttc8 T C 12: 98,937,144 S47P probably benign Het
Other mutations in Mc3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Mc3r APN 2 172249028 missense possibly damaging 0.95
IGL01618:Mc3r APN 2 172249370 missense probably benign
IGL01784:Mc3r APN 2 172249370 missense probably benign
IGL01865:Mc3r APN 2 172249055 missense probably damaging 1.00
IGL02164:Mc3r APN 2 172249394 missense probably damaging 1.00
IGL03011:Mc3r APN 2 172249796 missense probably benign 0.08
IGL03266:Mc3r APN 2 172249269 missense probably benign 0.01
R0882:Mc3r UTSW 2 172249791 missense probably benign 0.00
R1501:Mc3r UTSW 2 172249380 missense probably benign 0.19
R2374:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R3437:Mc3r UTSW 2 172249668 missense probably benign 0.23
R3813:Mc3r UTSW 2 172248879 missense probably benign 0.06
R3936:Mc3r UTSW 2 172249296 missense probably damaging 1.00
R4225:Mc3r UTSW 2 172249034 missense probably damaging 1.00
R4491:Mc3r UTSW 2 172249203 missense possibly damaging 0.50
R5074:Mc3r UTSW 2 172249613 missense possibly damaging 0.95
R5277:Mc3r UTSW 2 172249787 missense probably damaging 1.00
R5706:Mc3r UTSW 2 172249690 nonsense probably null
R5832:Mc3r UTSW 2 172249430 missense probably benign 0.01
R5865:Mc3r UTSW 2 172249672 missense possibly damaging 0.84
R5881:Mc3r UTSW 2 172249172 missense probably benign 0.22
R5905:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6028:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6492:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R7037:Mc3r UTSW 2 172249634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACGTCACCATCTTCTATGCCC -3'
(R):5'- CGATGACGGAGTTGCACATGATGAG -3'

Sequencing Primer
(F):5'- GAGGAAAGCCCTCACCTTG -3'
(R):5'- GTTGCACATGATGAGAACCAG -3'
Posted On2014-01-05