Mutagenetix > Incidental Mutation

Incidental Mutation 'R1122:Mrc1'

95701

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

039195-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R1122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 14266147 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000028045

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104704

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	G	A	11: 69,902,203 (GRCm39)	L469F	probably damaging	Het
Adgrb1	C	A	15: 74,419,534 (GRCm39)	R792S	probably damaging	Het
Aif1	G	A	17: 35,391,127 (GRCm39)	P44L	probably benign	Het
Arhgap15	A	T	2: 44,032,307 (GRCm39)	H297L	probably benign	Het
Chtf18	T	C	17: 25,943,597 (GRCm39)	E333G	probably damaging	Het
Cyb5a	A	G	18: 84,895,964 (GRCm39)	T77A	possibly damaging	Het
Entrep1	T	C	19: 23,952,756 (GRCm39)	E518G	probably damaging	Het
Exosc10	T	C	4: 148,650,821 (GRCm39)	W456R	possibly damaging	Het
Fhip2a	A	T	19: 57,370,733 (GRCm39)	T551S	probably benign	Het
Gad2	A	T	2: 22,513,463 (GRCm39)	Q31L	possibly damaging	Het
Gm9637	T	A	14: 19,401,879 (GRCm38)		noncoding transcript	Het
Itgav	A	G	2: 83,622,283 (GRCm39)	T622A	probably benign	Het
Kifc5b	T	A	17: 27,143,035 (GRCm39)	V269E	probably benign	Het
Lrrc15	T	C	16: 30,092,719 (GRCm39)	N207D	probably damaging	Het
Map2k5	A	G	9: 63,170,445 (GRCm39)	V291A	probably damaging	Het
Nckap1	C	T	2: 80,348,286 (GRCm39)	S889N	probably benign	Het
Or12d12	T	A	17: 37,611,019 (GRCm39)	Q98L	probably damaging	Het
Or1o2	T	A	17: 37,542,934 (GRCm39)	D109V	probably damaging	Het
Pdzd2	A	G	15: 12,457,981 (GRCm39)	V294A	probably benign	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Rnf220	C	T	4: 117,135,277 (GRCm39)	G171S	probably benign	Het
Slc6a4	T	C	11: 76,918,012 (GRCm39)	S585P	possibly damaging	Het
Slc7a8	T	C	14: 54,961,564 (GRCm39)	E528G	probably benign	Het
Slco4c1	A	G	1: 96,756,561 (GRCm39)	I587T	possibly damaging	Het
Syt4	T	A	18: 31,573,255 (GRCm39)	H420L	probably damaging	Het
Tec	T	C	5: 72,936,792 (GRCm39)	K236E	probably damaging	Het
Ttn	A	G	2: 76,545,676 (GRCm39)	V32549A	probably damaging	Het
Uqcc4	T	C	17: 25,403,846 (GRCm39)	I62T	probably benign	Het
Wdfy3	T	C	5: 102,030,832 (GRCm39)	H2299R	possibly damaging	Het
Zfp729b	A	G	13: 67,743,403 (GRCm39)	V64A	possibly damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAAGTCCATCATCAGAGCCTGGAA -3'
(R):5'- CCATCATGGATAATGTACCAAAGTCCCC -3'

Sequencing Primer
(F):5'- AAGAGCTGTGTGTCACTAAACC -3'
(R):5'- cccacccactcccacttc -3'

Posted On

2014-01-05