Incidental Mutation 'R1006:Zswim2'
ID95718
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
MMRRC Submission 039116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1006 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83915393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 567 (S567L)
Ref Sequence ENSEMBL: ENSMUSP00000044913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect probably damaging
Transcript: ENSMUST00000038223
AA Change: S567L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: S567L

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152829
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,458,441 I282N probably benign Het
Akr1c18 T C 13: 4,136,655 I265V probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Arfgef1 T C 1: 10,140,481 I1788V probably benign Het
Cacng7 T A 7: 3,366,929 I270N possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cnbd2 A G 2: 156,328,408 I138V possibly damaging Het
Cntnap5b A G 1: 100,383,617 K983E probably benign Het
Col14a1 T C 15: 55,519,935 S1770P probably benign Het
Cpsf6 A T 10: 117,366,068 probably benign Het
Ctsc G A 7: 88,309,829 R439H probably damaging Het
Dcun1d1 A G 3: 35,897,781 probably benign Het
Flg2 A G 3: 93,201,207 I181V probably benign Het
Gbp2 A T 3: 142,637,422 S567C probably damaging Het
Gm5114 A G 7: 39,409,086 S370P probably damaging Het
Kcnh7 A G 2: 62,716,183 V1018A probably benign Het
Kmt2a G A 9: 44,847,696 A952V probably damaging Het
Krt1 C T 15: 101,847,891 E340K possibly damaging Het
Lim2 T A 7: 43,435,402 I141N probably damaging Het
Nlrp4a T C 7: 26,453,467 V654A probably benign Het
Olfr1449 T A 19: 12,935,274 C179S probably damaging Het
Prr14l T C 5: 32,829,482 S890G probably benign Het
Psmd14 T A 2: 61,797,382 probably null Het
Ptpn13 A G 5: 103,586,789 D2129G probably benign Het
Pum1 C T 4: 130,771,888 T760M probably damaging Het
Rif1 A G 2: 52,085,029 I317V probably damaging Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Slfn8 A T 11: 83,003,511 H767Q possibly damaging Het
Sned1 G A 1: 93,256,392 G114D probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Tenm3 A T 8: 48,228,542 D2684E probably damaging Het
Tet2 T C 3: 133,476,601 T1201A possibly damaging Het
Vax2 T C 6: 83,737,777 S225P probably damaging Het
Vcan A G 13: 89,685,077 probably null Het
Washc5 T A 15: 59,369,186 Q100L probably benign Het
Washc5 G T 15: 59,369,187 Q100K probably benign Het
Zc3h13 A G 14: 75,330,549 D1094G probably damaging Het
Zmiz1 A G 14: 25,662,980 Y1051C unknown Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0943:Zswim2 UTSW 2 83917998 missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1191:Zswim2 UTSW 2 83923695 missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83925245 missense possibly damaging 0.94
R5698:Zswim2 UTSW 2 83925183 missense possibly damaging 0.92
R6002:Zswim2 UTSW 2 83915688 missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 unclassified probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTAGTCTCCCACGTAGCAGGAA -3'
(R):5'- ACAATGGACGACCTATGCTCAGTCA -3'

Sequencing Primer
(F):5'- TAGCAGGAAGACTTCTGTAAGCAC -3'
(R):5'- GACGACCTATGCTCAGTCAAATTAG -3'
Posted On2014-01-05