Incidental Mutation 'R1006:Ctsc'
ID 95751
Institutional Source Beutler Lab
Gene Symbol Ctsc
Ensembl Gene ENSMUSG00000030560
Gene Name cathepsin C
Synonyms dipeptidylpeptidase 1, DPPI, DPP1
MMRRC Submission 039116-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R1006 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 87927293-87960096 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87959037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 439 (R439H)
Ref Sequence ENSEMBL: ENSMUSP00000032779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032779] [ENSMUST00000128791]
AlphaFold P97821
Predicted Effect probably damaging
Transcript: ENSMUST00000032779
AA Change: R439H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032779
Gene: ENSMUSG00000030560
AA Change: R439H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 1.5e-48 PFAM
Pept_C1 230 457 1.05e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128791
SMART Domains Protein: ENSMUSP00000119503
Gene: ENSMUSG00000030560

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CathepsinC_exc 25 141 7.1e-62 PFAM
SCOP:d3gcb__ 144 254 4e-8 SMART
Blast:Pept_C1 229 254 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208302
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 93.4%
  • 20x: 82.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the dipeptidyl peptidase 1 light, heavy, and exclusion domain chains, which together comprise one subunit of the homotetrameric enzyme. This enzyme has amino dipeptidase activity and may play a role in the activation of granzymes during inflammation. Homozygous knockout mice for this gene exhibit impaired granzyme activation and enhanced survival in a sepsis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit cytotoxic lymphocytes with inactive granzymes A and B which are incapable of granule-mediated apoptosis. Mutant mast cells lack activated chymase activity. Homozygotes for other alleles display a scruffy coat with age and behavioral abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,911,085 (GRCm39) I282N probably benign Het
Akr1c18 T C 13: 4,186,654 (GRCm39) I265V probably benign Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Arfgef1 T C 1: 10,210,706 (GRCm39) I1788V probably benign Het
Cacng7 T A 7: 3,415,445 (GRCm39) I270N possibly damaging Het
Ccdc81 C T 7: 89,515,769 (GRCm39) E637K probably benign Het
Cnbd2 A G 2: 156,170,328 (GRCm39) I138V possibly damaging Het
Cntnap5b A G 1: 100,311,342 (GRCm39) K983E probably benign Het
Col14a1 T C 15: 55,383,331 (GRCm39) S1770P probably benign Het
Cpsf6 A T 10: 117,201,973 (GRCm39) probably benign Het
Dcun1d1 A G 3: 35,951,930 (GRCm39) probably benign Het
Flg2 A G 3: 93,108,514 (GRCm39) I181V probably benign Het
Gbp2 A T 3: 142,343,183 (GRCm39) S567C probably damaging Het
Gm5114 A G 7: 39,058,510 (GRCm39) S370P probably damaging Het
Kcnh7 A G 2: 62,546,527 (GRCm39) V1018A probably benign Het
Kmt2a G A 9: 44,758,993 (GRCm39) A952V probably damaging Het
Krt1 C T 15: 101,756,326 (GRCm39) E340K possibly damaging Het
Lim2 T A 7: 43,084,826 (GRCm39) I141N probably damaging Het
Nlrp4a T C 7: 26,152,892 (GRCm39) V654A probably benign Het
Or5b24 T A 19: 12,912,638 (GRCm39) C179S probably damaging Het
Prr14l T C 5: 32,986,826 (GRCm39) S890G probably benign Het
Psmd14 T A 2: 61,627,726 (GRCm39) probably null Het
Ptpn13 A G 5: 103,734,655 (GRCm39) D2129G probably benign Het
Pum1 C T 4: 130,499,199 (GRCm39) T760M probably damaging Het
Rif1 A G 2: 51,975,041 (GRCm39) I317V probably damaging Het
Sh3bgrl2 C T 9: 83,459,684 (GRCm39) probably benign Het
Slfn8 A T 11: 82,894,337 (GRCm39) H767Q possibly damaging Het
Sned1 G A 1: 93,184,114 (GRCm39) G114D probably damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Tenm3 A T 8: 48,681,577 (GRCm39) D2684E probably damaging Het
Tet2 T C 3: 133,182,362 (GRCm39) T1201A possibly damaging Het
Vax2 T C 6: 83,714,759 (GRCm39) S225P probably damaging Het
Vcan A G 13: 89,833,196 (GRCm39) probably null Het
Washc5 T A 15: 59,241,035 (GRCm39) Q100L probably benign Het
Washc5 G T 15: 59,241,036 (GRCm39) Q100K probably benign Het
Zc3h13 A G 14: 75,567,989 (GRCm39) D1094G probably damaging Het
Zmiz1 A G 14: 25,663,404 (GRCm39) Y1051C unknown Het
Zswim2 G A 2: 83,745,737 (GRCm39) S567L probably damaging Het
Other mutations in Ctsc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Ctsc APN 7 87,951,479 (GRCm39) missense possibly damaging 0.78
IGL02709:Ctsc APN 7 87,957,347 (GRCm39) missense probably damaging 0.99
IGL03103:Ctsc APN 7 87,959,013 (GRCm39) missense probably benign
IGL03117:Ctsc APN 7 87,958,988 (GRCm39) missense probably damaging 0.99
R0071:Ctsc UTSW 7 87,957,357 (GRCm39) unclassified probably benign
R0334:Ctsc UTSW 7 87,927,550 (GRCm39) missense possibly damaging 0.81
R0587:Ctsc UTSW 7 87,946,437 (GRCm39) missense probably benign 0.35
R1401:Ctsc UTSW 7 87,930,706 (GRCm39) missense probably damaging 1.00
R1472:Ctsc UTSW 7 87,930,670 (GRCm39) missense possibly damaging 0.88
R1602:Ctsc UTSW 7 87,927,512 (GRCm39) missense possibly damaging 0.77
R1650:Ctsc UTSW 7 87,930,634 (GRCm39) nonsense probably null
R1656:Ctsc UTSW 7 87,930,616 (GRCm39) missense possibly damaging 0.64
R1808:Ctsc UTSW 7 87,948,750 (GRCm39) missense possibly damaging 0.49
R3848:Ctsc UTSW 7 87,958,818 (GRCm39) missense probably benign 0.01
R4154:Ctsc UTSW 7 87,948,755 (GRCm39) missense probably benign 0.01
R4614:Ctsc UTSW 7 87,927,583 (GRCm39) critical splice donor site probably null
R5313:Ctsc UTSW 7 87,958,761 (GRCm39) missense probably damaging 1.00
R6863:Ctsc UTSW 7 87,951,486 (GRCm39) nonsense probably null
R6949:Ctsc UTSW 7 87,930,666 (GRCm39) missense probably damaging 1.00
R7220:Ctsc UTSW 7 87,946,361 (GRCm39) missense probably damaging 1.00
R7244:Ctsc UTSW 7 87,951,430 (GRCm39) missense probably benign
R7254:Ctsc UTSW 7 87,958,767 (GRCm39) missense probably damaging 1.00
R7732:Ctsc UTSW 7 87,946,367 (GRCm39) missense probably damaging 0.98
R8157:Ctsc UTSW 7 87,951,416 (GRCm39) missense probably benign 0.01
R8331:Ctsc UTSW 7 87,946,328 (GRCm39) missense possibly damaging 0.53
R8392:Ctsc UTSW 7 87,946,451 (GRCm39) missense probably benign 0.00
R8971:Ctsc UTSW 7 87,959,024 (GRCm39) missense probably benign 0.00
R9005:Ctsc UTSW 7 87,927,502 (GRCm39) missense probably damaging 1.00
R9113:Ctsc UTSW 7 87,959,104 (GRCm39) missense possibly damaging 0.93
R9131:Ctsc UTSW 7 87,959,016 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGGCTGAGTGACCCTTTCAAC -3'
(R):5'- GGCAGGTGATGAATCTTCACACTCC -3'

Sequencing Primer
(F):5'- TCAACCCCTTCGAGCTGAC -3'
(R):5'- ACATCTGGTTGCATTGTAGATGAC -3'
Posted On 2014-01-05