Incidental Mutation 'R1123:Etnk2'
ID95808
Institutional Source Beutler Lab
Gene Symbol Etnk2
Ensembl Gene ENSMUSG00000070644
Gene Nameethanolamine kinase 2
Synonyms4933417N20Rik, Eki2
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133363572-133380336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133373272 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 259 (D259G)
Ref Sequence ENSEMBL: ENSMUSP00000114272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129213] [ENSMUST00000135222]
Predicted Effect probably benign
Transcript: ENSMUST00000129213
AA Change: D156G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644
AA Change: D156G

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131450
Predicted Effect probably benign
Transcript: ENSMUST00000135222
AA Change: D259G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644
AA Change: D259G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156832
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutation of this gene results in maternal-specific intrauterine growth retardation resulting in reduced litter size and perinatal lethality due to extensive placental thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Etnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1551:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R1595:Etnk2 UTSW 1 133373179 missense possibly damaging 0.88
R1728:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1728:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1728:Etnk2 UTSW 1 133365816 nonsense probably null
R1728:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1728:Etnk2 UTSW 1 133376915 missense probably benign
R1729:Etnk2 UTSW 1 133363923 missense probably benign
R1729:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1729:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1729:Etnk2 UTSW 1 133365816 nonsense probably null
R1729:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1729:Etnk2 UTSW 1 133376915 missense probably benign
R1730:Etnk2 UTSW 1 133363923 missense probably benign
R1730:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1730:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1730:Etnk2 UTSW 1 133365816 nonsense probably null
R1730:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1730:Etnk2 UTSW 1 133376915 missense probably benign
R1739:Etnk2 UTSW 1 133363923 missense probably benign
R1739:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1739:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1739:Etnk2 UTSW 1 133365816 nonsense probably null
R1739:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1739:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1762:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1762:Etnk2 UTSW 1 133365816 nonsense probably null
R1762:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1762:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1783:Etnk2 UTSW 1 133363923 missense probably benign
R1783:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1783:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1783:Etnk2 UTSW 1 133365816 nonsense probably null
R1783:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1783:Etnk2 UTSW 1 133376915 missense probably benign
R1783:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1784:Etnk2 UTSW 1 133363890 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1784:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1784:Etnk2 UTSW 1 133365816 nonsense probably null
R1784:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133376915 missense probably benign
R1784:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1785:Etnk2 UTSW 1 133363923 missense probably benign
R1785:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1785:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1785:Etnk2 UTSW 1 133365816 nonsense probably null
R1785:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1785:Etnk2 UTSW 1 133376915 missense probably benign
R2089:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R5141:Etnk2 UTSW 1 133368862 missense probably benign 0.01
R5418:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R5586:Etnk2 UTSW 1 133379305 splice site probably null
R5922:Etnk2 UTSW 1 133363885 unclassified probably null
X0025:Etnk2 UTSW 1 133373239 missense probably damaging 1.00
X0026:Etnk2 UTSW 1 133365670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCACTCCGCAATGTGCAAC -3'
(R):5'- GGTGTCCTGATGCTAAAGAGCTTCC -3'

Sequencing Primer
(F):5'- CCGCAATGTGCAACCTTTTC -3'
(R):5'- GATGCTAAAGAGCTTCCTAGCTAAG -3'
Posted On2014-01-05